книжный портал
  к н и ж н ы й   п о р т а л
ЖАНРЫ
КНИГИ ПО ГОДАМ
КНИГИ ПО ИЗДАТЕЛЯМ
правообладателям

Адам Резерфорд

Краткая история всех, кто когда-либо жил

Стиву Джонсу

Стив Джонс был моим учителем и руководителем в Университетском колледже Лондона и за его пределами. На первом занятии в 1994 году он сообщил нам, неимущим студентам, что вернет деньги каждому, кто купит его знаменитую книгу «Язык генов». И я получил с него 55 пенсов. На протяжении многих лет он оказывал на меня такое сильное влияние, как, пожалуй, никто другой, так что данную книгу – с его разрешения – я рассматриваю как продолжение его классического труда. Когда в 2012 году я был удостоен чести выступить перед Британской гуманистической ассоциацией, Стив меня представлял. Надеюсь, он пошутил, когда сказал, что очень остро ощущает, как я жду его смерти, чтобы унаследовать его научные достижения. Поскольку он все еще жив и с благодарностью за 55 пенсов, я посвящаю эту книгу.

Предисловие автора

Наука – занятие коллективное. В науке не бывает одиноких гениев или злых гениев, и лишь изредка встречаются гении-еретики. Почти всегда науку делают совершенно обычные люди, собирающиеся группами или работающие в сотрудничестве с другими людьми из той же или из другой области исследований. И все, что они делают, строится на плечах гигантов мысли прошлых лет или современности. Так считал еще Исаак Ньютон, повторяя слова философа XI века Бернарда Шартрского, а тот, в свою очередь, пересказывал греческий миф об ослепленном богами охотнике Орионе, дорогу которому указывал сидевший у него на плечах карлик.

Наука, о которой пойдет речь в этой книге, возможно, требует взаимодействия еще большего числа людей, чем большинство других наук, поскольку она связана с внедрением нового метода геномики в такие старые области исследования, как история, археология, палеоантропология, медицина и психология. Список авторов современных статей по генетике может содержать десятки, сотни и иногда даже тысячи имен. Давно миновали времена, когда изучением природы занимались только джентльмены, получившие богатое наследство.

В создании книги мне помогали множество людей, кроме того, я изучил большое количество научных статей, процитированных в конце книги. Однако в тексте я почти не делал сносок и не указывал конкретный источник информации, чтобы не прерывать повествование. Большая часть материала предоставлена мне Марком Томасом из Университетского колледжа Лондона, и я очень благодарен ему за помощь и дружбу на протяжении многих лет. Изучением древней ДНК в настоящее время занимаются всего в нескольких лабораториях мира, однако по мере усовершенствования технологии и накопления данных эти исследования набирают обороты. Часть представленного материала я почерпнул из работ Сванте Паабо, Тури Кинг и ее проекта «Ричард III», Джо Пикрелла, Дэвида Рейха, Джошуа Эйки, Йоахима Бергера, Грэхема Купа, Йоханнеса Краузе и некоторых других людей, помогавших мне прямо или косвенно. Представленные в книге данные принадлежат им, ошибки – мне. В конце книги я привел список технических и малопонятных терминов, которыми часто пользуются генетики.

Введение

В будущем, я предвижу, откроется еще новое важное поле исследования. …Много света будет пролито на происхождение человека и на его историю.

Чарлз Дарвин. О происхождении видов, глава 14, 1859 г.

Эта история о вас. Она рассказывает о том, кто вы такой и как вы появились на свет. Это только ваша история, поскольку жизнь каждого человека – уникальное явление, но это и наша общая история, поскольку вы, как представитель всего рода человеческого, одновременно и типичны, и исключительны. Несмотря на различия между людьми, все мы – ближайшие родственники. Наше семейное дерево совсем не похоже на дерево, но все мы – его плоды.

Считается, что за все времена на Земле жило около 107 миллиардов людей современного типа, однако эта цифра зависит от того, откуда начать считать. Все мы – близкие родственники, поскольку весь наш вид произошел из Африки. Честно говоря, мы не знаем толком, что это значит. Это не значит, например, что мы произошли от одной пары людей – гипотетических Адама и Евы. Обычно, когда мы говорим о родстве, мы имеем в виду семьи, генеалогию, предков. И об отдаленном прошлом мы пытаемся думать таким же образом. Кем были ваши предки? Это могла быть традиционная семья, или, как у меня, невозможный клубок, напоминающий спутанные куски старых проводов. Но на каком-то этапе история каждого рода скрывается в тумане прошлого.

Каждый из нас имел двух родителей, и каждый из наших родителей имел двух родителей, и те тоже имели двух родителей… Если продолжать в том же духе, двигаясь назад до последнего завоевания Англии и удваивая число людей в каждом предыдущем поколении, мы получим гораздо больше, чем 107 миллиардов. В чем тут ошибка? Дело в том, что наши с вами родословные переплетаются, ветви дерева замыкаются в петли, и эта единая сеть родства охватывает каждого, кто когда-либо жил на свете. Нужно вернуться назад лишь на несколько десятков столетий, чтобы понять, что все семь миллиардов ныне живущих людей происходят от крохотной группы предков – буквально от населения одной деревни.

Письменная история (или просто история) – это тот отрезок времени, события которого мы тем или иным образом зарегистрировали. На протяжении тысячелетий мы рисовали, вырезали, записывали и пересказывали свое прошлое и настоящее, чтобы понять, кто мы такие и откуда мы взялись. Считается, что история началась с изобретения письменности. До этого был так называемый доисторический период, когда люди ничего не записывали. Жизнь на Земле зародилась примерно 3,9 миллиарда лет назад. Вид Homo sapiens, к которому мы с вами принадлежим, появился всего 200 тысяч лет назад в восточной части Африки. Первая письменность возникла около 6000 лет назад в Месопотамии – где-то в той местности, которую мы сегодня называем Средним Востоком.

Книга, которую вы сейчас держите в руках, насчитывает примерно 111 тысяч слов, или 660 тысяч знаков (с пробелами). Если эту книгу сравнить со временем существования жизни на Земле, каждому знаку, включая пробелы, будет соответствовать 5909 лет. В таком измерении время существования современного человека эквивалентно

…точной протяженности данной фразы.

А длительность человеческой письменной истории в таком случае сводится к одному-единственному знаку – не больше этой точки ‹…›

И как разрозненны фрагменты этой истории! Письменные документы исчезают, растворяются, рассыпаются. Их убивает погода, насекомые или бактерии, их намеренно уничтожают, выкрадывают, подделывают или переписывают с искажениями. Я уже не говорю об объективности исторических записей. Мы не можем прийти к единому мнению относительно событий десятилетней давности. Газеты очевидно пристрастны. За камерами тоже стоят люди, которые записывают только то, что происходит прямо перед ними, часто в отрыве от контекста. Да и сами люди – чрезвычайно ненадежный источник объективной информации. Так что мы пребываем в темноте.

Подробности событий 11 сентября 2001 года, когда были взорваны башни Всемирного торгового центра, так и останутся неизвестными из-за несогласующихся свидетельств и всеобщего хаоса. Показания свидетелей в суде всегда пристрастны и необъективны и должны оцениваться критически. Обернемся назад всего на несколько столетий и обнаружим, что у нас нет никаких свидетельств современников, повествующих о жизни Иисуса Христа – одного из самых влиятельных людей в истории. Большинство рассказов о его жизни было записано через несколько десятилетий после его смерти людьми, которые никогда его не видели. И сегодня историческая достоверность подобных документов представляется неоднозначной. Даже Евангелие, на которое опирается христианское вероучение, противоречиво и необратимо изменялось во времени.

Впрочем, это вовсе не означает, что не следует изучать историю (в том числе историю христианства). Это просто комментарий, иллюстрирующий туманность прошлого. До недавнего времени история записывалась главным образом в виде религиозных текстов, торговых соглашений и королевских указов. В новое время возникла другая проблема: мы получаем слишком много информации и практически не имеем возможности ее оценивать. Каждый раз, покупая или разыскивая что-то в Интернете, вы сообщаете информацию о себе. Книги, рассказы, записи, археологические находки, Интернет, базы данных, фильмы, радио, жесткие диски, пленка: мы накапливаем эти биты и байты информации, пытаясь по ним восстановить прошлое. Теперь биология тоже стала частью этой груды информации.

Эпиграф в начале книги – единственное упоминание о человеке, сделанное Дарвином в книге «О происхождении видов». Эта фраза находится почти в самом конце, как будто автор поддразнивает нас и подразумевает, что на этом рассказ не заканчивается. Его теория наследования модификаций в отдаленном будущем прольет свет и на нашу историю: ждите продолжения.

И это время наступило. Появился новый способ прочесть нашу историю, и наше происхождение осветилось яркими огнями. Каждый из нас несет этот рассказ в собственных клетках. И это совершенно уникальная и извилистая история. Примерно через 50 лет после открытия двойной спирали ДНК мы так хорошо научились расшифровывать последовательности ДНК, что генетический материал стал для нас историческим документом, доступным для подробного анализа. В геноме, генах и ДНК каждого из нас записано все, что происходило на Земле, – четыре миллиарда лет экспериментов, в результате которых появились и вы. Ваш геном – сумма всей вашей ДНК, примерно три миллиарда букв, и таинственный (с точки зрения биолога) способ полового размножения, приведший к созданию вашей последовательности ДНК, тоже уникален. Этот генетический «отпечаток пальца» принадлежит только вам и отличается от «отпечатков» 107 миллиардов людей, когда-либо живших на Земле. Даже если вы с братом или сестрой однояйцевые близнецы, ваши геномы поначалу были неразличимы, но сразу после зачатия начали расходиться. Как у Доктора Сьюза[1]:

Сегодня вы – это вы! Это правдивее правды!

Нет никого на свете, кто был бы больше вы, чем вы!

Сперма, из которой вы получились, появилась в семенниках вашего отца за несколько дней до вашего зачатия. Один-единственный сперматозоид из нескольких миллиардов добрался до яйцеклетки вашей матери – одной из нескольких сотен. Яйцеклетки, как матрешки, зародились в теле вашей матери, пока она была еще в утробе своей матери, но эта конкретная яйцеклетка созрела в ходе последнего менструального цикла. Яйцеклетки поочередно выходят из каждого яичника, покидая место своего рождения. При контакте с яйцеклеткой сперматозоид-победитель выделяет химическое вещество, растворяющее мембрану яйцеклетки, отбрасывает хвост и внедряется внутрь. Как только он оказывается внутри, яйцеклетка выстраивает непреодолимую оборонительную систему, так что другие сперматозоиды больше не могут в нее проникнуть. Яйцеклетка и сперматозоид были уникальными, уникальным является и их сочетание, из которого появились вы. Даже место проникновения сперматозоида в яйцеклетку было уникальным: яйцеклетка имеет почти сферическую форму, и сперматозоид – с позволения звезд – проник в нее в каком-то специфическом месте, откуда стали поступать химические сигналы, и откуда началось построение вашего тела: голова с одной стороны, хвост – с другой. Для некоторых организмов известно, что направление роста эмбриона зависит от места проникновения сперматозоида-победителя в яйцеклетку; возможно, то же самое справедливо и для человека.

Генетический материал ваших родителей, их геном, при образовании сперматозоидов и яйцеклеток перемешался и разделился пополам. Родители ваших родителей – ваши дедушки и бабушки – снабдили их двумя наборами хромосом, и при перемешивании образовался набор, которого никогда прежде не было и никогда не будет. Но вам досталось и некоторое количество неперетасованной ДНК. Если вы мужчина, у вас есть Y-хромосома, которая почти в идентичной форме присутствует у всех мужчин вашего рода. Это махонький кусочек ДНК, содержащий всего несколько генов и множество обрывков. В митохондриях яйцеклетки – маленьких электростанциях, снабжающих клетки энергией, – также содержатся небольшие кольцевые молекулы ДНК. Митохондриальный геном, находящийся внутри яйцеклетки, достается каждому человеку только от матери. Эти не подвергающиеся перемешиванию последовательности ДНК составляют лишь малую часть всего генома, однако с их помощью можно проследить за происхождением и древнейшей историей организма. Но большая часть вашей ДНК образовалась в результате перемешивания ДНК ваших родителей, их родителей и родителей их родителей. Этот процесс происходит всегда и не прерывался ни разу до вашего появления на свет.

Задалбливают мать с отцом:

тебе суют они, «любя»,

свои огрехи, все, гуртом,

плюс кучку сверх – лишь для тебя[2].

Я не буду комментировать психологические или моральные аспекты стихотворения Филипа Ларкина, но в биологическом плане все верно. Каждый раз, когда образуются сперматозоиды и яйцеклетки, в результате перемешивания ДНК возникают новые варианты, что делает уникальным каждого владеющего ими человека. Вы наследуете уникальную комбинацию ДНК ваших родителей, и в результате процесса мейоза (редукционного деления) вы тоже создадите новые генетические варианты. Некоторые из них достанутся вашим детям, а они, в свою очередь, создадут новые варианты.

Именно эти различия между организмами в популяции являются точкой приложения эволюционного процесса, и именно благодаря этим различиям мы можем проследить путь человечества – наш путь – через сушу и океаны, и через океаны времени до каждого уголка планеты. Так что теперь генетики вдруг стали историками.

Каждый геном содержит множество информации – вполне достаточно, чтобы «спроектировать» человека. Однако геномика – сравнительная наука, и в рамках этой науки два человеческих генома содержат больше, чем двойной набор такой информации. В геномах всех людей присутствуют одни и те же гены, но все они могут чуточку различаться между собой. Именно поэтому все мы невероятно похожи, и одновременно с этим каждый из нас совершенно уникален. Анализируя эти различия, мы можем установить степень родства между двумя людьми и момент возникновения различий. Более того, теперь мы можем провести подобный анализ для всего человечества: для этого нам нужна только ДНК всех людей.

Когда под звуки фанфар в 2001 году была обнародована первая «полная» последовательность человеческого генома, это, вообще говоря, была только приблизительная версия основной части генетического материала нескольких человек. Чтобы продвинуться дальше, сотни ученых трудились на протяжении еще почти десяти лет, и стоило это удовольствие около трех миллиардов долларов США – примерно один доллар за букву ДНК. Прошло всего 15 лет, и проведение такого анализа сильно упростилось; теперь мы владеем гигантским количеством данных, полученных в результате секвенирования геномов многих людей. Сейчас, когда я пишу эти строки, прочитано уже около 150 тысяч полных человеческих геномов и собрано множество полезных образцов буквально от миллионов людей со всего мира. В рамках крупных медицинских проектов с выразительными названиями типа «Сто тысяч геномов» с легкостью извлекаются данные, хранящиеся в человеческих клетках. У нас в Великобритании серьезно подумывают о том, чтобы анализировать геном каждого новорожденного. И речь идет не только о науке или государственной медицине: каждый может поплевать в пробирку и обратиться в одну из многочисленных специализированных компаний за информацией о содержании ключевых элементов генома. Вам расскажут массу интересного о вашем характере, происхождении и риске возникновения определенных заболеваний. И это обойдется всего в пару сотен фунтов.

Более того, ученые расшифровали последовательности геномов сотен давно умерших людей, которые теперь тоже являются частью общего рассказа. В 2014 году были найдены кости английского короля Ричарда III (глава 3). Археологи подозревали, что кости принадлежали королю, но окончательную точку в этом деле удалось поставить благодаря анализу ДНК. Мы знаем о королях и королевах прошлых лет благодаря их особому положению, и практически вся история в целом строится на рассказах о них и их деяниях. Генетика еще больше расширила возможности изучения истории монархов, однако ДНК – универсальный уравнитель, и благодаря новым технологическим возможностям мы можем подробно изучать историю всех людей и народов и их перемещений. Мы можем проверить и подтвердить или опровергнуть историю каждого человека, а не только знаменитых или могущественных персон. Неизвестные персонажи из прошлого становятся в один ряд с самыми известными людьми. ДНК универсальна, и хотя наличие королевской крови, как мы увидим, может подтвердить данные Богом права на управление другими членами общества и на все привилегии наследуемой власти, законы эволюции, генетики и полового размножения практически не связаны с национальностью, сословиями и властью.

Но это не все. Раньше изучение древних людей сводилось к анализу выкопанных зубов, костей и других призрачных следов их земного бытия, но теперь мы в состоянии получить информацию об очень древних людях – неандертальцах и других вымерших представителях нашего обширного семейства, и это дает нам возможность понять, что мы представляем собой сегодня. На основании их ДНК мы можем получить информацию, которую нельзя добыть никаким иным путем. Мы можем, например, узнать, как неандертальцы распознавали запахи. Анализ древней ДНК заставил нас пересмотреть историю нашей эволюции. Возможно, границы в страну прошлого для нас закрыты, но карта этой страны находится внутри нас.

Новая наука генерирует колоссальное, феноменальное, невообразимое количество данных. Каждую неделю публикуется новая информация, переворачивающая наши старые представления. Когда я приближался к завершению работы над книгой, появилось сообщение о результатах анализа 47 найденных в Китае человеческих зубов, из которых следовало, что великий исход человечества из Африки, возможно, произошел на 10 тысяч лет раньше, чем мы считали до сих пор. А когда я фактически закончил писать, этот эпизод в истории человечества отодвинулся еще на 20 тысяч лет назад, поскольку ДНК Homo sapiens была обнаружена у древней неандертальской девушки. Десятки тысяч лет – не очень большой срок для эволюции и совсем уж незначительный для геологии. Но это гораздо больше, чем вся письменная история человечества, так что земля у нас под ногами буквально ходит ходуном.

Первая часть книги посвящена пересмотру истории человечества – от появления на Земле как минимум четырех видов людей до европейских королей XVIII века – в свете новых генетических данных. Вторая часть рассказывает о том, какими мы стали теперь и что изучение ДНК в XXI веке может рассказать нам о нашей семье, здоровье, психологии, расовой принадлежности и о нашей судьбе. Материалом для написания обеих частей была ДНК, а также традиционные источники информации: археология, окаменелости, старые кости, легенды, хроники и семейные предания.

В то время как изучение семейного дерева и наследования столь же старо, как само человечество, генетика – очень молодое научное направление с катастрофически краткой историей. Генетика человека зародилась как метод сравнительного анализа людей для формального научного описания различий между ними с целью оправдания сегрегации и неравенства. Одновременно с генетикой родилась евгеника – учение об улучшении наследственных свойств человека, и тогда, в конце XIX века, это слово не несло в себе такого ужасного смысла, как сегодня. Ни в одной области науки нет такого противоречивого предмета изучения, как раса: люди различаются между собой, и эти различия стали причиной глубочайшего разделения и самых жестоких и кровавых эпизодов в истории. Как мы увидим, современная генетика показывает, насколько ошибочной оказалась концепция расового разделения.

Людям нравится рассказывать истории. Мы обожаем истории, особенно такие, которые раскрывают суть вещей и объясняют невероятную сложность человеческого бытия, имея при этом начало, продолжение и конец. Когда мы начали расшифровывать геном, мы как раз искали связь истории и культуры с индивидуальными особенностями каждого человека, чтобы понять, кто мы такие и почему.

Но наши надежды не оправдались. Человеческий геном оказался намного более интересным и сложным, чем могли предположить даже сами генетики, которые плодотворно работали над его анализом еще на протяжении десяти лет после «завершения» проекта «Геном человека». Сложности расшифровки и понимания генома отчасти связаны с тем, что мы, вообще говоря, понимаем под генетикой. Когда-то мы вели свою родословную, основываясь на понятии «крови», «кровного родства». Теперь мы знаем, что дело не в крови, а в генах. И теперь символом судьбы стали называть ДНК. Но ДНК – это не судьба. Все ученые предпочитают думать, что публике хуже всего известна именно та область науки, в которой они работают. И я как ученый и писатель могу сказать, что хуже всего люди понимают то, что происходит в области генетики человека, возможно, по той причине, что нам мешают наши культурные традиции.

Наука умело доказывает, что мир на космическом, молекулярном, атомном или субатомном уровне совсем не такой, каким мы его видим. Но эти сферы весьма далеки и абстрактны по сравнению с темой семьи, наследственности, расы, разума и истории. К обсуждению этих важнейших аспектов человеческого бытия мы подходим, вооружившись невероятным объемом традиционных представлений и предубеждений. Между научными и бытовыми представлениями о семье и расе находится не пробел, а пропасть, поскольку, как мы увидим далее, положение вещей совсем не такое, как мы привыкли думать.

Кроме того, с ДНК связано множество нелепостей и мифов. Генетика, конечно же, может рассказать, кто является вашими ближайшими родственниками, и раскрыть множество загадок из глубокого прошлого. Однако у вас с вашими предками гораздо меньше общего, чем вы думаете, а от каких-то членов вашей семьи вы вовсе не унаследовали генов и, следовательно, не имеете с ними генетического родства, хотя в генеалогическом плане, безусловно, от них происходите. Кроме того, я расскажу вам, что генетики не в состоянии предсказать, насколько умными будут ваши дети, каким спортом они будут заниматься, на человеке какого пола женятся или как умрут, и почему некоторые люди совершают чудовищные преступления и убийства (хотя вам, возможно, приходилось слышать обратное). Очень важно понимать, что генетика может сделать и чего она сделать не может.

Именно с помощью ДНК закодирован наш сложный мозг, который заставляет людей задаваться вопросом о собственном происхождении и пытаться понять ход эволюции. На протяжении тысячелетий в этой необычной молекуле накапливались и записывались изменения, ожидая, когда мы сможем их прочесть. И теперь мы умеем это делать.

Каждая глава книги содержит отдельный рассказ об истории и о генетике, о выигранных и проигранных битвах, о захватчиках, мародерах и убийцах, о перемещении народов, сельском хозяйстве, болезнях, королях и королевах, о чуме и о сексе.

В первую очередь это историческая книга. Здесь есть истории о развитии генетики – со всеми ее замысловатыми поворотами и темными пятнами. Здесь есть рассказы о различных нациях и народах; некоторые из них известны благодаря судьбам знаменитых людей, властелинов мира сего, но по большому счету историю делает анонимное множество людей. И теперь у нас есть возможность анализировать кости умерших при необычных обстоятельствах мужчин, женщин и детей, изучить их жизнь путем анализа ДНК, что пополняет наши знания истории.

Биология – наука о том, что живет и, следовательно, умирает. Это беспорядочная – удивительно беспорядочная! – и неточная наука, плохо поддающаяся определениям. И если вы хотите начать ее освоение с самого начала, что кажется вполне логичным, знайте, что именно здесь и начинается путаница.

Часть первая

Как мы появились

1

Подвижные и похотливые

Там нет ни начала, ни конца, ни напряженности сюжета, ни морали, ни причин, ни следствий. Мы любим в наших книгах главным образом глубину многих чудесных моментов, увиденных сразу, в одно и то же время. Курт Воннегут. Бойня номер 5. (перевод Р. Райт-Ковалевой)

Воннегут был прав наполовину. Совершенно очевидно, что начала не существует, да и конец, если есть, то весьма неопределенный. Мы всегда находимся в середине, мы все – промежуточные звенья. Как нельзя с точностью сказать, в какой момент начинается жизнь конкретного человека, так нельзя сказать, в какой момент творения возник наш вид, когда зародилась искра жизни, когда Господь вдохнул душу в глиняного Адама, когда треснула скорлупа космического яйца. Жизнь – это процесс. В ней нет ничего постоянного, и все живые организмы четырехмерны – существуют в пространстве и во времени.

Жизнь – это переход: все по-настоящему статичное уже мертво. У ваших родителей были родители, и у них были родители, и так дальше – парами, уходящими в глубь истории и доисторических времен. Если вы будете отступать во времени все назад и назад, постепенно и неизбежно вы перестанете узнавать своих предков. Постепенно, через высших приматов и обезьян, вы доберетесь до других двуногих и четвероногих млекопитающих, грызунов и прочих наземных тварей, а за ними обнаружите водяных существ и рыб, и червей, и морские растения. А отступив назад примерно на два миллиарда лет, вы обнаружите, что ваши предки не выстраивались парами, поскольку жизнь тогда продолжалась просто путем бинарного деления индивидуальных клеток, в результате которого из одной клетки получаются две. Наконец, в самом начале развития жизни на Земле, примерно четыре миллиарда лет назад, на дне океана вы обнаружите гидротермальный источник с пузырящейся теплой водой.

Этот медленный поэтапный процесс похож на цветовую диаграмму, в которой – пиксель за пикселем – белое становится черным: так рептилии превращаются в млекопитающих, а четвероногие – в двуногих. Время от времени наблюдаются цветовые всплески, но в целом путь к предкам можно назвать скорее плавным, чем скачкообразным[3], и чем глубже, тем более густым становится серый цвет.

Тогда жизнь развивалась непрерывным путем, и люди – точка на этом сером континууме. Представьте себе типичную лохматую четвероногую обезьяну, справа от нее – согнутую обезьяну, еще правее – сутулую человекообразную обезьяну, затем – волосатого, похожего на нас человека с приподнятой ногой, прикрывающей инструмент биологической эволюции, видеть который нам с вами не полагается. Этот канонический образ известен всем, только теперь мы понимаем, что он ошибочен. Во-первых, нам точно не известно, каким был путь превращения обезьяны в человека. Мы знаем некоторые этапы этого превращения, но многое на этом пути по-прежнему скрыто в тумане. Во-вторых, наше представление о направленности этой эволюции ошибочно. Мы привыкли считать, что эволюция шла в сторону формирования двуногого существа с большим и мощным мозгом, способным создавать орудия труда и произведения искусства. Именно так мы понимаем прогресс – от простого к сложному, с обязательным революционным изменением познавательной способности мозга.

Однако дело в том, что мы с вами эволюционировали не больше и не меньше, чем любые другие существа. Наша уникальность невероятно преувеличена. Мы уникальны ровно в той же степени, что и существа любого другого вида, которые эволюционировали с одной целью – обеспечить максимальную возможность передачи генов своим потомкам в бесконечно разнообразных условиях существования. Все, что нам известно об эволюции, включая последние данные генетики, не позволяет описать превращение обезьяны в человека слева направо за двадцать шагов, не говоря уже о пяти. Прогресс эволюции измерить невозможно, и принятая ранее терминология, в которой виды делились на «высшие» и «низшие», больше не имеет под собой никакой научной основы.

Чарлз Дарвин пользовался этой терминологией, когда описывал механизм происхождения видов в 1859 году, поскольку другой терминологии просто не было[4]. У него было мало данных о других прямоходящих приматах с копьями или без копий. И он не знал способов передачи модификаций из поколения в поколение.

В конце XIX века мы начали понимать, как признаки родителей передаются детям. В 1940-х годах мы узнали, что за передачу наследственной информации отвечает молекула ДНК. В 1953 году мы выяснили, что ДНК представляет собой двойную спираль, благодаря чему она может копировать себя, а на основании этих копий могут возникать новые клетки – точно такие же, как те, из которых они получились. А в 1960-х годах мы узнали, каким образом в ДНК закодированы белки, и поняли, что вся жизнь построена белками и из белков. Такие гиганты мысли, как Грегор Мендель, Фрэнсис Крик, Джеймс Уотсон, Розалинд Франклин и Морис Уилкинс, стояли на плечах своих предшественников и коллег и, в свою очередь, подставили плечи биологам будущего. Разгадки этих великих тайн биологии стоят в ряду важнейших исторических событий XX века, и благодаря им к началу XXI века удалось сформулировать основные принципы биологии. Разгадав универсальный генетический код и структуру двойной спирали ДНК, мы определили ряд простейших и важнейших принципов жизни. Однако постепенно выяснилось, что эти простейшие принципы чрезвычайно сложны.

Но Дарвин ничего этого не знал. Когда в 1871 году он опубликовал книгу «Происхождение человека», его в первую очередь волновал вопрос, «произошел ли человек, как и любой другой вид, от какой-то прежде существовавшей формы». На тот момент были обнаружены останки лишь нескольких представителей ветви неандертальцев: один череп был найден в Бельгии, другой в районе Гибралтара и еще несколько костей – в центральной части Германии. В 1837 году Дарвин составил набросок эволюционного дерева, на котором показал, как из одной ветви появляются две и т. д. в ответ на изменяющиеся внешние условия. Но было непонятно, как древние человекообразные существа вписываются в человеческое дерево жизни.

С XIX века считается, что мы не изначально сотворены такими, как есть, а эволюционировали, как и остальные животные.

«Я думаю», – нацарапал он вверху страницы дневника своим неподражаемо ужасным почерком, но так и не закончил фразу. В XIX веке утвердилось мнение, что мы, наряду с другими животными, являемся частью континуума и, следовательно, рождены, а не сотворены. Сегодня только тот, кто не хочет ничего знать, отвергает идею нашей эволюции от предшествовавших видов. Всем известны изображения улыбающихся черепов наших давно вымерших предков, а об открытии новых видов сообщают на первых страницах газет и журналов. Десятки линий доказательств однозначно показывают, что мы принадлежим к высшим приматам и что у нас и шимпанзе, бонобо, горилл и орангутанов был общий предок.

Иногда говорят, что окаменелостей, свидетельствующих о ранней эволюции человека, так мало, что все их можно разместить на одном большом столе или сложить в один ящик. Это не так. У нас есть тысячи древних окаменелых костей, найденных в разных частях света. Некоторые относятся к самому началу человеческой истории на востоке Африки, некоторые обнаружены в Европе. И чем больше мы ищем, тем больше находим. Однако для Дарвина мы были единственной точкой в конце загадочной ветви нашего семейного дерева.

Но для сумасшедших археологов, всю жизнь просиживающих в тесных пещерах или в покрытых пылью пересохших речных руслах, вооруженных зубными щетками и крохотными кирками, этого количества образцов, безусловно, мало, чтобы восстановить целостную картину появления человека. Они собирают кости отдельных людей по группам в соответствии со сходством характеристик, таких как форма бровей, плюсневых костей или зубов. На образцах указывают место обнаружения, культурный слой и найденные рядом предметы – орудия труда, охотничье оружие или следы приготовления пищи.

Если эти образцы достаточно «молодые», в них можно определить соотношение изотопов углерода: при жизни человека эти изотопы восполняются за счет метаболизма, но после смерти их соотношение медленно изменяется определенным образом. Это хорошая, надежная наука. Иногда спорная, как любая наука, иногда фрагментарная, однако анализ старых костей – точный, комплексный и сложный метод. За 200 лет, прошедших с момента открытия останков людей других видов, мы очень многое узнали о появлении человека, однако теперь мы уже не уверены в том, что это происходило именно так, как мы думали раньше. На протяжении многих десятилетий схема превращения обезьяны в человека красовалась на стенах музеев всех стран мира и во многих учебниках – простая и понятная линия эволюции с подписью «Вот так мы появились на свет». В доме-музее Дарвина «Даун-Хаус» в графстве Кент, где ученый оттачивал свою потрясающую идею, до сих пор можно купить кружку с такой картинкой.

В 1980-х годах, когда я был молод и влюбился в науку, эволюционное дерево человека выглядело именно таким образом. Отец собирал для меня вырезки из New Scientist и Scientific American с четкими разветвляющимися диаграммами, которые показывали, как один вид превращается в другой, или как из одного вида образуются два новых вида, а все «менее развитые» родственники человека отмирают по дороге. Картинка была четкой и понятной, поскольку образцов было немного. Но к концу XX века ученые откопали множество костей древних людей разных видов. И четкие линии филогенетического дерева стали утолщаться, расплываться и терять направленность.

Похоже, пришло время отказаться от старой метафоры об эволюционном «дереве» и уж точно – от привычной картинки, описывающей превращение обезьяны в человека. Сегодня эта схема настолько перестала быть похожей на дерево, что ее не сравнишь даже с кустом. Теперь она больше напоминает ряд перевернутых капель, ручейками, речушками и мощными потоками текущих вверх в озера и океаны, одно из которых и есть мы; одни достигают вершины, другие угасают по дороге (см. рисунок). Иначе эту же схему можно изобразить в виде диаграммы, расположив найденные образцы разных видов организмов снизу, от самых старых, доверху, где будем только мы – единственный сохранившийся вид, – так, чтобы ширина полос соответствовала географической широте распространения окаменелостей. В таком случае придется признать, что связи между видами окажутся прерывистыми, то есть гипотетическими. Если бы речь шла о детективной истории, мы бы сказали, что труп есть, но факты относительно обстоятельств убийства скупы и разрозненны. До разгадки еще далеко.

Безусловно, мы чрезвычайно горды собой – и не без основания. Мы – всего лишь один из видов животных, но мы – единственный вид, который исследует собственную природу, смотрится в зеркало и наблюдает за собой. О нашем происхождении написано множество книг, но я буду рассказывать только о тех данных, которые позволяют восстановить историю и древнейшие связи с использованием самых новых методов палеоантропологии и анализа ДНК. Буквально за несколько последних десятилетий молекула ДНК перевернула наши взгляды на историю человечества. Эта область исследований развивается с такой невероятной скоростью, что ученые боятся публиковать результаты, поскольку общая картина меняется не за месяцы или годы, а за недели или даже считаные дни. Работать в данной области науки, прямо скажем, непросто, поскольку она переживает неослабевающий революционный переворот. Путь нашей эволюции обрастает подробностями, но многое еще предстоит выяснить.

Прежде чем погрузиться в это исследование, давайте кратко поговорим о том, как эта история выглядела в начале. Вернее, начнем не с начала, поскольку начала нет, а с произвольной точки вблизи начала.

Запутанный куст эволюционного развития человечества.[5]

Анализ старых костей и ДНК привел к тому, что когда-то простое и понятное разветвляющееся филогенетическое дерево превратилось в спутанный куст. Жирные линии соответствуют разным видам людей, а пунктир показывает перенос генов за счет межвидового скрещивания. Чем больше мы узнаем, тем запутаннее становится эта схема.

* * *

Двуногие обезьяны жили на Земле уже как минимум четыре миллиона лет назад. На самом деле все обезьяны способны в какой-то степени передвигаться на двух ногах, но когда мы говорим о двуногих видах, мы имеем в виду, что для них это обычный способ передвижения. Выпрямление спины было важнейшим этапом нашей эволюции. Оно совпало по времени с целым рядом анатомических перестроек (например, в положении и форме позвоночника и его сочленении с черепом) или стало их причиной. Ученые пока не пришли к единому мнению по поводу того, почему это произошло, но гипотез существует множество. Некоторые считают, что в таком положении повышается эффективность движений, другие видят в этом изменении адаптацию к жизни в саваннах, а не в лесах, а третьи связывают этот переход с изменением климата в Восточно-Африканской рифтовой долине. Самый известный представитель той давнишней эпохи – Люси, родившаяся примерно 3,2 миллиона лет назад. Сорок процентов ее окаменелого скелета (что очень много для таких старых костей) было открыто в 1974 году Дональдом Карлом Джохансоном. Ее назвали Люси по той причине, что ночью в лагере палеонтологов в долине Аваш в Эфиопии звучала песня «Битлз» «Люси в небесах с алмазами». Люси – один из первых обнаруженных представителей вида Australopithecus afarensis. Мы не знаем, был ли этот вид нашим непосредственным предшественником. Но мы знаем, что он нам ближе, чем многие другие приматы того времени.

Классификация животных весьма запутана, но, чтобы рассказать историю нашего вида, придется ей воспользоваться.

Принятая на сегодняшний день система классификации была предложена в XVIII веке шведским натуралистом Карлом Линнеем. В соответствии с этой классификацией все организмы определяются двумя латинскими названиями, соответствующими роду и виду[6]. В этой системе английский дуб носит название Quercus robur. Lalapa lusa – это оса, Ba humbug – фиджийская змея, Enema pan – скарабей. Обычная жаба называется Bufo bufo – ленивое название, латинский эквивалент «жаба жаба». Вообще говоря, многие распространенные животные имеют такие двойные названия, например, моллюск Extra extra или наш родственник Gorilla gorilla[7]. Но дома у вас живет Felis catus, кошка домашняя, – вот ей выделили два разных имени, хотя, если перевести с латинского, это будет звучать как «кошка кошка».

Название Australopithecus afarensis приблизительно можно перевести как «южное человекообразное существо из далекого прошлого». Существуют и другие виды «южных человекообразных существ», например sediba, anamensis и africanus. Раньше человекообразных обезьян относили к родам Sivapithecus («обезьяна Шивы, обнаруженная в Индии»), Ardipithecus («наземная обезьяна») и Gigantopithecus («по-настоящему большая обезьяна»).

Мы с вами относимся к роду Homo и виду sapiens: Homo sapiens, человек разумный. Это краткая версия классификационного названия. Знаете, как дети пишут свой адрес, начиная от номера дома и названия улицы и заканчивая страной, континентом, полушарием, Солнечной системой и галактикой? Так и в биологии. Чтобы точно определить наше положение в живой вселенной, следует написать следующее:

Домен: эукариоты (сложные клетки)

Царство: животные

Тип: хордовые (животные со спинной осью, например с позвоночником)

Класс: млекопитающие

Порядок: приматы (сюда относятся обезьяны, человекообразные обезьяны, долгопяты и некоторые другие существа)

Подпорядок: сухоносые обезьяны

Семейство: гоминиды (крупные человекообразные обезьяны)

Все, о ком пойдет рассказ дальше в этой книге, относятся к роду Homo (люди). Так, неандертальцы получили название Homo neanderthalensis – люди из долины Неандерталь в Германии; а первым представителем рода Homo считается Homo habilis – человек умелый.

Мы являемся членами удивительного закрытого клуба. Принадлежность к роду не обязательно указывает на сходство между представителями рода, однако указывает на то, что они похожи друг на друга больше, чем на любых других существ. На сегодняшний день это лучшая имеющаяся у нас система классификации.

Определение вида тоже неоднозначно, но принято считать, что существа относятся к двум разным видам, если при скрещивании они не могут произвести способное к воспроизведению потомство. Зеброиды (гибрид зебры с лошадью или ослом), лигры (гибрид льва и тигрицы), мулы (гибрид осла и кобылы), лошаки (гибрид жеребца и ослицы) и пизли (гибрид белого и бурого медведя – редкое, но чрезвычайно опасное животное) являются вполне жизнеспособными существами, но никто из них не может произвести на свет жизнеспособное потомство. Вскоре мы увидим, почему такое определение вида не годится для человека.

По современной договоренности, к роду Homo относят семь видов существ, которых я буду называть людьми. Этот подход неоднозначен, но одна из проблем таксономии заключается в том, что, давая организмам имена, мы одновременно пытаемся дать им определение, не учитывая эволюционной природы жизни. Вспомните, что эволюция действует на уровне ДНК, но классификация этого не учитывает.

На данный момент давайте говорить о видах как об отдельных группах животных, различающихся настолько, что в результате их скрещивания не может появиться способное к размножению потомство. И в рамках рода Homo таких групп насчитывалось как минимум семь[8]. Тех людей, которых мы знаем по окаменелостям и которые жили около миллиона лет назад, мы называем архаическими (древнейшими) людьми. К ним относились Homo ergaster (Человек работающий), H. antecessor (Человек предшествующий), H. Heidelbergensis (Человек гейдельбергский), и некоторые другие; все они жили в разных местах и имели несколько различающееся анатомическое строение. Считается, что они произошли от более раннего вида Homo erectus – человека прямоходящего. Эти люди расселились по всему миру, но пока мы не смогли раздобыть их ДНК для анализа, а в нашем с вами исследовании мы пытаемся восстановить прошлое на основании анализа ДНК. Большинство других видов тоже не оставили нам своей ДНК (по крайней мере, пока мы ее не извлекли): либо потому, что представители вида умерли слишком давно, либо потому, что умерли в слишком жарких регионах, где ДНК плохо сохраняется. Так что наши гипотезы о связи с этими видами основываются на анализе окаменелостей и данных палеоархеологии.

Основания пирамиды человеческой эволюции задрожали в 2003 году, когда на индонезийском острове Флорес были обнаружены кости крохотной женщины. В пещере Лианг-Буа ученые откопали останки скелета женщины ростом не более одного метра и еще как минимум восьмерых людей. Назвали этих миниатюрных людей Homo floresiensis, а прозвали «хоббитами» (впрочем, хотя ступня у них была широкая, у нас нет никаких доказательств, что они были покрыты шерстью). Жили они в этой влажной пещере 13 тысяч лет назад – всего за несколько столетий до изобретения современным человеком сельского хозяйства. Маленькие люди готовили пищу на огне и, возможно, ели мясо обитавших поблизости гигантских крыс и стегодонов (вид мелких слонов).

Кем были эти маленькие люди? Из первых публикаций в журнале Nature следовало, что строение тела позволяло отнести их к роду Homo, но все же имело такие отличия, которые заставляли считать их отдельным видом. Меньшинство ученых критиковали эту идею и утверждали, что эти древние люди были такими же, как мы, но болели и уменьшились в росте в результате какой-то патологии. В качестве гипотез предлагали синдром Дауна, микроцефалию, карликовость Ларона и эндемичный кретинизм, но никаких надежных доказательств справедливости этих гипотез не было найдено. Жители островов часто бывают очень маленькими или очень высокими, поскольку в таких местах условия естественного отбора могут быть весьма специфическими. В частности, наши «хоббиты» делили территорию с гигантскими грызунами, крохотными гиппопотамами и малюсенькими слонами. Все эти странные существа вымерли, но все же кажется наиболее вероятным, что Homo floresiensis – отдельный вид человека и, возможно, где-то на отрезке в два миллиона лет мы с ними имели общего предка. А уменьшение размера тела действительно могло произойти в специфических условиях жизни на тропических островах.

К сожалению, у нас нет ДНК этих крошек. Их кости не окаменели, а остались мягкими, как картон. В 2009 году ученые попытались выделить ДНК из одного зуба, поскольку крепкая внешняя поверхность зубов в какой-то степени может защитить ДНК от разрушения. Попытка не удалась, и ДНК Homo floresiensis потеряна для нас, как слезы в дождевой воде. По-видимому, теплый и влажный климат тропиков за несколько тысячелетий уничтожил всю ДНК, содержавшуюся в зубах и костях. Это очень досадно, поскольку анализ ДНК позволил бы мгновенно определить происхождение этих людей. Их островная жизнь, ограниченность распространения и физические характеристики, скорее всего, говорят о том, что индонезийские «хоббиты» не были нашими предками, но приходились нам дальними родственниками. Тем не менее в результате этого открытия число видов людей, живших 50 тысяч лет назад, вдруг выросло от двух до трех, что прославило «хоббитов», а также других гигантских и крохотных обитателей островов. А наша планета стала напоминать толкиеновское Средиземье[9].

Учимся читать

С развитием методов анализа ДНК продолжается уточнение наших представлений об эволюции человека. На протяжении сотни с лишним лет в изучении эволюции человека мы опирались на анализ костей и некоторые другие данные из области анатомии и поведения (культуры). Расшифровку ДНК можно сравнить с изучением анатомии на молекулярном уровне. Форма костей и ее изменения в процессе эволюции тоже записаны в ДНК. Изначально технологию секвенирования ДНК развивали для изучения причин заболеваний, но расшифровка генома, безусловно, позволит также прояснить историю человечества.

Вот вкратце рассказ о том, как мы научились читать ДНК. В 1997 году на всех парах стартовал самый крупный научный проект в области генетики человека. Несколько сотен ученых (в том числе, бывшие конкуренты) собрались в одну команду, объединенную общей целью – представить миру полную последовательность ДНК человеческого генома – все три миллиарда знаков. Подробнее о проекте «Геном человека» говорится в главе 5, здесь заметим только, что это была большая технологическая программа, направленная на упрощение и удешевление расшифровки ДНК. Реализация проекта позволила революционизировать медицину, а также, прояснив темные пятна в эволюции, разгадать некоторые загадки человеческого бытия.

Первый метод расшифровки ДНК, заключенный в многократном копировании исходной последовательности, предложил английский ученый Фред Сенгер.

Метод расшифровки ДНК впервые был предложен скромным английским гением Фредом Сенгером в конце 1970-х годов. Он заключался в многократном копировании исходной последовательности. Для такой процедуры требуется смесь молекул, из которых состоит алфавит ДНК. Любая ДНК построена всего из четырех букв (нуклеотидных оснований): A, T, C и G. Кроме того, для секвенирования нужна матрица ДНК и фермент (полимераза), который копирует основания и связывает их между собой. Если поместить все эти ингредиенты в пробирку и установить правильную температуру, двойная спираль ДНК разделится на две отдельные нити, каждая из которых послужит матрицей для синтеза второй нити. В конце реакции вы получите миллион копий исходного фрагмента ДНК. Последовательность ДНК непрерывна, в отличие, например, от текстов на английском языке, которые всегда разделены на предложения, заканчивающиеся точками. Каждая буква в этой последовательности соединена химической связью с предыдущей и последующей буквой. Молекула полимеразы постепенно продвигается вдоль матрицы, присоединяя по одной новой букве за раз, как пишущая машинка, копирующая строчку текста. Кроме того, в реакционную смесь для секвенирования ДНК добавляют еще некоторое количество молекул, при встраивании которых происходит обрыв растущей цепочки.

Поскольку в ходе реакции образуется множество копий исходной молекулы ДНК, а обрыв цепи происходит случайным образом, в конце реакции получается набор молекул, обрывающихся на

ка

каж

кажд

каждой

каждой б

каждой бу

каждой бук

каждой букв

каждой букве

каждой букве (исходной последовательности).

Таким образом, секвенирование ДНК представляет собой воспроизведение исходной матрицы. Вы создаете миллионы копий разной длины, оканчивающиеся абсолютно на каждой букве исходной последовательности. Дальше нужно расположить эти фрагменты в порядке увеличения длины. Молекулы ДНК несут отрицательный заряд и поэтому, если вы поместите их в солевой раствор и подключите напряжение, ДНК будет двигаться к положительному электроду. Скорость перемещения зависит от массы фрагмента (от его длины): длинные фрагменты движутся медленнее, короткие быстрее. Если же вы поместите фрагменты ДНК не в солевой раствор, а в гель, и включите электрический ток, фрагменты ДНК разделятся в геле в соответствии с размером.

Но для проведения реакции нужно учесть еще кое-что. В ДНК всего четыре буквы (а не 26, как в английском языке), поэтому исходную ДНК нужно поместить в четыре пробирки. В каждую пробирку нужно внести все ингредиенты, но, кроме того, в первую добавить немного измененных оснований A, которые останавливают реакцию, когда в матрице встречаются основания A. Во вторую пробирку нужно внести все ингредиенты плюс небольшое количество останавливающих реакцию оснований C. То же самое с оставшимися пробирками для оснований T и G. Когда реакция завершается, у вас имеется одна пробирка, в которой все фрагменты заканчиваются на A, вторая пробирка с окончанием фрагментов на C, третья с окончанием на T и четвертая с окончанием на G. Если вы нанесете содержимое этих пробирок в четыре соседние лунки в геле и подключите напряжение, фрагменты разделятся в зависимости от размера, и вы сможете определить положение каждой буквы в исходной молекуле ДНК.

Например, первая колонка может выглядеть так:

*****AA**A*****A******A*A***A*

Вторая так:

**T*T**T**T*T*T*T*T*T****T*T**

Третья так:

C**C****C**C*********C*C**C**C

И четвертая так:

*G*********G*G**********

И если вы наложите друг на друга эти последовательности, то получите исходный фрагмент:

CGTCTAATCATCTGTATGTGTCACATCTAC

Если вы когда-нибудь видели по телевизору ученых с длинными листами с изображением множества черных полосок, расположенных ровными колонками, значит, вы видели именно это. Это последовательность букв в ДНК из наших клеток, которую мы не могли прочесть на протяжении четырех миллиардов лет, но теперь можем определить за считаные минуты и недорого. За изобретение этого замечательного способа чтения последовательностей ДНК Сенгер совершенно заслуженно получил свою вторую Нобелевскую премию по химии в 1980 году[10].

В 1990-х годах, когда в рамках проекта «Геном человека» предстояло определить последовательность трех миллиардов букв человеческого генома, метод Сенгера был видоизменен и автоматизирован. В главе 5 будет говориться о том, почему работа над проектом была столь сложной, и почему для ее выполнения потребовалось так много времени и денег. В 1990-х годах я был студентом и отправлял короткие фрагменты очищенной ДНК на анализ в специализированную лабораторию, занимавшуюся секвенированием, и несколько дней ждал результатов (не в виде красивых фотографий, а в виде компьютерных файлов). Теперь большинство генетических лабораторий имеют собственные приборы (секвенаторы) и за несколько часов считывают мегабайты информации. Появились новые технологии, которые не вытеснили метод Сенгера полностью, но позволили работать быстрее и с меньшими затратами, и если вы начинаете карьеру генетика в наши дни, возможно, вы лично никогда не воспользуетесь методом Сенгера. Уже существуют секвенаторы размером с колоду карт, которые подключаются к переносному компьютеру через USB, так что вы можете брать их с собой для полевых исследований и секвенировать геномы растений и животных прямо на природе. Все эти нововведения стимулируют революцию в генетике, которая коснется всех нас. К примеру, мы уже научились анализировать ДНК давно умерших людей.

И у смерти не будет господства[11]

В земле лежал давным-давно умерший человек. Может быть, его тело положили сюда родственники, или он здесь и умер, не подозревая, что станет одним из самых важных людей за всю историю человечества. Спустя много-много лет после смерти этот человек сделал две вещи. Прежде всего, обнаружение его костей в 1856 году стало толчком к изучению древних людей. Он жил на территории современной Германии, в долине Неандер, примерно 40 тысяч лет назад. Пещеры Фельдхофер, где нашли кости, больше не существует: она была разрушена при строительстве каменоломни.

Зато сохранились описания. Вход в пещеру находился на несколько метров выше уровня земли: узкий лаз вел в каменную комнату размером примерно три на пять метров, с высоким потолком. В этом месте археологами-любителями, а потом и профессионалами были обнаружены тысячи артефактов, включая останки как минимум трех человек. В уже упомянутом 1856 году рабочие каменоломен обнаружили несколько окаменелых костей: фрагмент черепа размером с подставку под пивную кружку, две бедренные кости, несколько костей рук (больше, чем нужно одному человеку), а также фрагменты лопаток и ребер; все это они отнесли местному антропологу.

Останки человека, не относящегося к виду Homo sapiens, были обнаружены не впервые (кажется, это был третий подобный экземпляр), однако они оказались «типичными»: именно они определили признаки вида, и именно с ними стали сравнивать все следующие находки. Название вида: Homo neanderthalensis, как вы уже поняли, связано с этим типичным образцом. Возможно, у этого человека было имя при жизни, но для нас он стал Неандертальцем 1 (Neanderthal 1). С его формальной идентификацией связано начало развития палеоантропологии – науки о древних людях.

Но это еще не все. Второй революционный переворот Неандерталец 1 совершил еще через 150 лет. Он предоставил ученым свою ДНК. В холодной пещере его останки в какой-то степени были защищены от хищных животных и всепожирающих бактерий, которые в других условиях уничтожили бы все следы его существования. В этом необычном убежище кости оставались нетронутыми на протяжении сорока тысяч лет. В результате в 1997 году Неандерталец 1 стал первым членом закрытого клуба людей, не относящихся к виду Homo sapiens. Внутри медленно разрушающихся клеток его руки, которой он, возможно, метал копье, были обнаружены молекулы наследственности, несущие свое послание из прошлого в будущее.

В рамках проекта «Геном человека» был исследован геном не только современных людей. Возможно, вам это покажется странным, но изначально в задачи проекта было заложено изучение шести видов существ. Геном раскрывает гораздо больше информации, если его сравнить с другим геномом, в том числе, с геномом организма другого вида. По этой причине в «геномный клуб», кроме нас, вошли следующие существа: любимые модельные организмы ученых – фруктовая муха Drosophila melanogaster, крыса и мышь; затем наши ближайшие родственники шимпанзе; затем медоносная пчела (по той причине, что она является социальным животным; кроме того, большинство членов пчелиной семьи вообще не участвуют в производстве потомства, а только служат королеве, с которой разделяют ровно половину своей ДНК). Геномы этих существ уже были прочитаны и расшифрованы в конце XX века.

В 1997 году, используя такую же технологию, как для анализа ДНК живых людей, работавший в Лейпциге шведский ученый фактически заложил основы нового революционного научного направления – палеогенетики. Сванте Паабо извлек из музея в Бонне правую плечевую кость Неандертальца 1. С невероятными предосторожностями вырезал из середины кости фрагмент длиной 2,5 см, обнажив то, что когда-то было живым костным мозгом, в котором зарождались кровяные и иммунные клетки. В костном мозге возникает множество разных клеток, которые чрезвычайно быстро делятся и, следовательно, быстро воспроизводят свой генетический материал. Здесь и был найден первый клад – ДНК неандертальцев.

ДНК всех живых существ универсальна. Но она организована разными способами – как язык организован в виде книг, глав, памфлетов или даже оригами. И по наследству она передается тоже по-разному. У животных ДНК существует в виде хромосом – гигантских фрагментов двойной спирали, закрученных вокруг самих себя и вокруг маленьких бугристых белков; весь этот комплекс свернут таким образом, что образует знакомую нам по учебникам X-образную структуру. Большинство наших клеток содержат двойной набор хромосом: один унаследован от отца, другой от матери. Эти 23 пары хромосом бережно упакованы в ядре – маленьком гнездышке в центре клетки.

Однако биология – наука, состоящая из исключений и бесконечных ограничений, так что и в данном случае следует учесть, что идентичны хромосомы только в 22 парах (их называют аутосомами), а одна пара – непарная. Непарные хромосомы – это половые хромосомы. У меня одна Y- и одна X-хромосома, а у женщин пару составляют две X-хромосомы. Женщины получают по одной X-хромосоме от каждого из родителей, а мужчины получают Y-хромосому от отца. Однако, хотя Y-хромосома важна для определения пола, по сравнению с другими хромосомами она бедна информацией и содержит лишь незначительную часть суммарной ДНК. А вот X-хромосома – вторая крупнейшая хромосома из всего человеческого набора хромосом.

Есть еще одно исключение, касающееся передачи ДНК от родителей детям. Аутосомы и половые хромосомы никогда не покидают ядра. Однако существуют микроскопические, но невероятно важные молекулы ДНК, которые содержатся не в ядре, а в митохондриях – крохотных энергетических центрах, от которых зависят все сложные формы жизни. Эти клеточные органеллы образовались примерно два миллиарда лет назад в процессе слияния двух одноклеточных организмов. Образовавшиеся новые клетки, эукариоты, стали новой ветвью жизни, которая отличалась от всех существовавших ранее одноклеточных организмов, а именно, бактерий и архей. Три группы организмов (эукариоты, бактерии и археи) называют доменами – это верхняя ступень в иерархии живых существ, расположенная выше ступени пяти царств. К эукариотам фактически относятся все организмы, не относящиеся к бактериям или археям. Именно в эукариотах и содержатся крохотные клеточные электростанции, митохондрии, а в них хранится небольшое количество очень важной ДНК. Если слабенькая Y-хромосома передается от отца к сыну, митохондриальная ДНК (мтДНК) передается детям только от матери. Сперматозоиды содержат лишь половину генетической информации, необходимой для создания нового организма: 22 хромосомы, а также X- или Y-хромосому (что определяет пол будущего ребенка). Яйцеклетки тоже содержат лишь половинный набор информации: 22 хромосомы и X-хромосому, а также материнскую мтДНК.

Почти вся человеческая ДНК (более 97 %) содержится в 22 парных хромосомах и X-хромосоме, и вся эта информация наследуется от обоих родителей примерно в равной пропорции. Каждая аутосома представляет собой уникальную комбинацию ДНК, унаследованную вашими родителями от их родителей. Когда в семенниках мужчины и в яичниках женщины[12] образуются сперматозоиды и яйцеклетки, происходит выравнивание парных хромосом и их перестройка. Представьте, что в лежащих рядом наборах червовых и трефовых карт вы меняете местами несколько карт одинакового достоинства. В результате у вас сохраняется два полных набора карт в правильном порядке, только они представляют собой смесь червей и треф. То же самое происходит с хромосомами при образовании половых клеток. Только хромосомы обмениваются не королями и тузами, а миллионами фрагментов ДНК. Таким образом, каждая из 22 аутосом представляет собой новую комбинацию генов. Этот процесс, называемый рекомбинацией, объясняет генетическую уникальность каждого человека.

Однако с митохондриями и Y-хромосомой ничего подобного не происходит. Митохондриальная ДНК достается человеку от матери, ей – от ее матери и т. д. по материнской линии, а Y-хромосома точно так же передается по отцовской линии. Для тех, кто хочет выяснить свое происхождение, эта ДНК предоставляется удобным инструментом и используется во множестве экспериментов (не в последнюю очередь по причине ее малого размера), так что именно на анализе этой ДНК были основаны первые исследования в генеалогии. Митохондрий в клетке миллионы и поэтому весьма высока вероятность сохранения этой ДНК на протяжении длительного времени. Аутосомы и половые хромосомы существуют в виде единого набора только внутри клеточного ядра. Поэтому по сравнению с ядерной ДНК миллионы идентичных копий митохондриальной ДНК представляют собой гораздо более надежный источник информации. В нашем рассказе мы часто будем упоминать как мтДНК, так и Y-хромосому, впрочем, не только по той причине, что они несут в себе полезную информацию, но и поскольку порой их роль в поиске предков сильно преувеличивают.

Неандертальцы жили почти на всей территории Западной Европы (от восточного края Испании до пещер Уэльса), в горах Центральной Азии и дальше к югу, вплоть до территории Израиля. Возраст самых старых костей неандертальцев, которые мы достоверно идентифицировали, составляет 300 тысяч лет, и нет костей, которые были бы моложе 30 тысяч лет. Это довольно длительный период для существования человеческого вида. Еще более ранний вид, Homo erectus, расселился по всему миру после выхода из Африки, который начался 1,9 миллиона лет назад. Но недавно выяснилось, что неандертальцы оставили в истории более долгий след, чем мы предполагали раньше. Считается, что анатомически современный человек появился в Восточной Африке примерно 200 тысяч лет назад, а потом, в свою очередь, покинул пределы африканского континента (примерно 100 тысяч лет назад).

Эти цифры уточняются каждые пять лет по мере обнаружения новых образцов. В октябре 2015 года в пещере Фуян в провинции Даосянь на юге Китая нашли 47 зубов современного человека; возраст зубов составляет не менее 80 тысяч лет, и логично предположить, что их обладатели проделали путь от того места, где появились (Восточная Африка), до пещеры в Китае как минимум за несколько десятков тысячелетий.

В соответствии с представлениями традиционной палеоантропологии, основанной на изучении костей, к тому времени, когда Homo sapiens пришли в Европу (около 60 тысяч лет назад), неандертальцы уже прекрасно здесь обжились, хотя жили небольшими группами. Но если учитывать результаты анализа ДНК, эту гипотезу следует подвергнуть серьезной ревизии (мы поговорим об этом ниже).

Тем не менее изучение анатомии неандертальцев показывает, что они, совершенно определенно, отличались от других людей. Одним из важнейших параметров в палеоантропологии является размер мозга – так вот у неандертальцев он был больше, чем у нас. Объем мозга современного мужчины составляет около 1,4 литра, у женщин – чуть меньше. Объем мозга неандертальцев составлял от 1,2 до 1,7 литра. Объем мозга нельзя напрямую связать с уровнем интеллектуальных способностей, однако в целом у человекообразных обезьян больший объем мозга соответствует более сложной организации.

Неандертальцы были ниже нас ростом, коренастыми, с выпуклой грудной клеткой, широким носом и тяжелыми надбровными дугами. Очевидно, именно из-за этих физических признаков они приобрели у нас неважную репутацию. В нашем понимании они олицетворяют неотесанных пещерных людей, и порой «неандертальцами» называют тупоголовых бандитов. Когда в XIX веке впервые осуществлялась классификация древних людей, великий немецкий биолог Эрнст Геккель предложил назвать один вид Homo stupidus (Человек глупый).

Однако ничто не подтверждает, что неандертальцы были именно такими и что они значительно отличались по интеллекту от своих современников вида Homo sapiens. Они охотились, разделывали и готовили крупную дичь. Есть данные, что уже 100 тысяч лет назад они шили одежду и изготавливали украшения, и все это было до прибытия современного человека, так что неандертальцы до всего додумались сами, а не подсмотрели у соседей. Недавно ученые заявили, что настенные рисунки в пещере Нерхи на юге Испании выполнены ими, а не нами. Некоторые также считают, что наличие пыльцы в могильниках в пещере Шанидар в Ираке и на юге Франции[13] объясняется тем, что неандертальцы использовали в похоронном ритуале цветы, хотя пока это лишь гипотеза.

Из-за недостаточного количества материала вопрос об эволюционном родстве между Homo neanderthalensis и Homo sapiens долгое время оставался открытым. Было выдвинуто множество гипотез, начиная с того, что неандертальцы были прямыми предками современных европейцев, и заканчивая тем, что они были несвязанной с нами ветвью эволюционного дерева и не оставили потомков, доживших до наших дней. Считалось, что наш с ними общий предок жил примерно 600 тысяч лет назад.

Первым этапом этого исследования стала работа Сванте Паабо по изучению ДНК из руки Неандертальца 1. Из среза кости ученые извлекли 0,4 грамма вещества (крохотная щепотка соли) и выделили из него фрагменты мтДНК. Тогда, в 1997 году, это была самая старая когда-либо изученная ДНК. Вообще говоря, цель всего исследования в значительной степени заключалась в том, чтобы показать, что такой анализ вообще возможен и что выделенная ДНК не была современным загрязнением. В 1990-х годах был очень популярен фильм «Парк Юрского периода», и идея извлечения ДНК давным-давно вымерших существ казалась невероятно привлекательной. Реальность, как обычно, оказалась банальнее кинематографических историй. Выделенная ДНК рассыпалась на короткие и сильно поврежденные фрагменты, как рассыпается на клочки древняя книга. В отличие от костей воскресшего динозавра[14] из «Парка Юрского периода», которому было более 65 миллионов лет, этой ДНК было «всего лишь» 40 тысяч, но она не отличалась хорошим состоянием. Паабо с коллегами удалось кое-что выудить из этого материала только благодаря новым навыкам, приобретенным генетиками за время работы над проектом «Геном человека». Это был первый детский шажок на пути расшифровки и восстановления прошлого.

Переселение Homo sapiens из Африки.

Человек современной анатомии (неоантроп) появился в Восточной Африке примерно 200 тысяч лет назад и впервые покинул этот континент как минимум 100 тысяч лет назад. По дороге популяции современных людей встречали людей других видов, а в Европе встретили неандертальцев, и на основании анализа нашей ДНК можно утверждать, что они скрещивались.

Прежде всего было обнаружено, что ДНК неандертальца отлична от мтДНК современных людей. Проанализированные фрагменты позволяли с высокой долей вероятности утверждать, что эта часть генома разошлась с геномом предшественников современных людей до появления нашего общего предка. ДНК изменяется со временем достаточно предсказуемым образом, так что сравнение двух похожих, но различимых последовательностей позволяет определить, когда они разошлись. (Технология эта несовершенна, но некоторые предварительные выводы сделать можно.). По результатам исследования ДНК неандертальца расхождение между нашими ветвями было отнесено к периоду от 690 до 550 тысяч лет назад. Это одновременно соответствовало традиционным представлениям и об эволюции человека (мы – не неандертальцы), и данным палеоантропологии и археологии. Так что эксперимент не нарушил status quo. Но он приоткрыл дверь в прошлое, и в последующие десятилетия все изменилось.

Революция в биологии происходила невероятно бурно, сдерживаемая лишь недостатком технических возможностей. Выделять старую ДНК очень сложно, и такие эксперименты по зубам только настоящим экспертам. Сегодня осуществить секвенирование генов живого организма проще простого: сделать это сможет любой человек после пары дней обучения при наличии необходимого оборудования, и опыт требуется лишь для анализа и расшифровки результатов. Но древняя ДНК очень хрупкая, и чтение генов давно умерших существ – совсем не стандартная задача.

Однако, как и при выполнении проекта «Геном человека», расшифрованные фрагменты ДНК становятся достоянием широкой общественности. Древние геномы публикуются в виде баз данных, с которыми может работать любой желающий. Сегодня генетикам не нужно держать в руках окаменелые кости или отправляться на раскопки, чтобы изучить гены предков, умерших много тысяч лет назад. Им нужен только Интернет. В ходе первых экспериментов были разработаны новые методы хранения и анализа древней ДНК, поскольку доступного для изучения материала было чрезвычайно мало.

В 2006 году другая исследовательская группа успешно выделила ДНК из хорватского неандертальца возрастом 38 тысяч лет и попыталась ответить на некоторые старые вопросы. За неделю в двух самых престижных научных журналах, Science и Nature, вышли сразу две статьи с похожими результатами (и похожим составом авторов). Основной вывод, сделанный в этих двух исследованиях, заключался в том, что наши предки отделились от предков неандертальцев примерно 500 тысяч лет назад. Однако в одной статье утверждалось, что позднее две линии могли перекрещиваться, а в другой – что этого не было.

Наконец, в 2010 году секвенирование генома неандертальца было завершено. Группа Сванте Паабо значительно усовершенствовала методы работы с древней ДНК. Из пыли, обломков и фрагментов окаменелых костей они собрали полный чертеж генома.

Только вдумайтесь, что произошло! Развитие технологии шло с поистине ошеломляющей скоростью. Геном современного человека был почти полностью расшифрован лишь в 2001 году (а окончательно только в 2003 году, мы поговорим об этом в главе 5). И всего через несколько лет ученым удалось собрать геном вымершего человеческого вида, используя кости, пролежавшие в земле десятки тысяч лет. Можно сказать, что Паабо и его коллеги изобрели машину времени.

Каков же этот геном? Какие в нем содержатся гены и что они могут рассказать о людях, которые так похожи и так не похожи на нас? Эту тему мы будем развивать на протяжении всей книги, поскольку она противоречит общепринятой идее о том, что гены – это судьба и что какой-то вариант гена полностью определяет жизнь и характеристики человека. Генетикам понятно, что это не так, однако эта идея пока еще находит культурную основу и часто поддерживается средствами массовой информации для упрощения невероятно сложной биологии человека. Знание последовательности какого-то гена конкретного человека позволяет получить некий ограниченный объем информации, если только этот ген не относится к сравнительно небольшой группе чрезвычайно важных генов. Позднее мы поговорим об этом подробнее, а сейчас заметим только, что ученые нашли способ анализировать гены давно умерших существ.

На экзамене по палеоантропологии студентов часто спрашивают, умели ли неандертальцы говорить. Правильный ответ (развернутый, содержащий не менее трех тысяч слов на основе имеющихся анатомических доказательств) сводится к тому, что скорее всего – да. Строение их горла было таким же, как у нас, а анализ подъязычной кости, обнаруженной в пещере Кебара в Израиле в 1989 году, указывает, что речевая функция могла быть развита у неандертальцев в такой же степени, что и у нас. Подъязычная кость – это кость в форме подковы, расположенная в том месте, где шея встречается с подбородком. Чтобы ее нащупать, обхватите горло большим и указательным пальцами (в том месте, где можно человека задушить) и сглотните слюну. У человека эта кость удерживается двенадцатью небольшими мышцами, связывающими ее с языком, нижним небом, гортанью, глоткой и надгортанником. Довольно много мышц для такой небольшой косточки, а это означает, что она специально адаптирована для какого-то характерного для нас занятия. Подъязычная кость из Кебары была предметом множества микроанатомических исследований из-за ее возможного участия в речевом процессе у неандертальцев. И ответ звучит именно так: неандертальцы, скорее всего, могли разговаривать, как мы.

В неврологическом плане мы тоже не очень сильно от них отличаемся. Как можно догадаться, речевая функция поддерживается обширным участком мозга. В формировании речи участвуют многие отделы мозга, но основную роль играет так называемая область Брока, названная в честь французского нейроанатома XIX века, обследовавшего двух пациентов, потерявших способность говорить после травмы этого отдела мозга. Познания в нейроанатомии не позволят нам судить о речевой способности неандертальцев, поскольку область Брока – довольно большой фрагмент мозга, который иногда можно обнаружить в мясном рагу. Он есть и у других крупных человекообразных обезьян, хотя говорить они не умеют. Так что, учитывая большой размер мозга неандертальцев, логично предположить, что область Брока у них тоже была на месте.

Вы, наверное, догадываетесь, что узнать о том, говорили ли неандертальцы, можно с помощью новейших генетических методов. Существует ген, который много изучали и восхваляли и который напрямую связан с речевой функцией. Он называется FOXP2, и хотя мы не знаем точно, что еще он делает в организме, уже ясно, что он играет ключевую роль в осуществлении речевой функции, которая для нас, в отличие от других человекообразных обезьян и вообще всех других обитателей планеты, так легка и очевидна. Один из лучших способов изучить функцию гена заключается в том, чтобы посмотреть, что происходит, когда этот ген испорчен. Ученые проделывают это в экспериментах на животных, целенаправленным или случайным образом отключая различные гены. По очевидным причинам мы не делаем таких экспериментов на людях, поэтому нам приходится анализировать случаи различных заболеваний и нарушений.

Ген FOXP2 был открыт в 1990 году в моем родном Институте Детского здоровья при Университетском колледже Лондона (это исследовательское отделение детского госпиталя). С тех пор было описано несколько мутаций гена. В частности, была исследована семья пакистанцев (назовем их инициалами КЕ) с наследственной формой артикуляционной диспраксии, в результате которой дети не могут произносить многие гласные и согласные звуки. Поскольку этот дефект был наследственным (в явном виде наблюдался у 16 членов семьи), это позволило идентифицировать отличающийся от нормы участок на хромосоме 17, а дальнейшие исследования показали наличие ошибки в конкретном гене[15]. С тех пор о гене FOXP2 много писали, в том числе в популярной прессе, которая называет его «геном грамотности» или «геном языка». Однако он не является ни тем ни другим, поскольку речь – сложный поведенческий комплекс, контролируемый множеством генетических факторов, а вовсе не одним геном[16]. Однако он действительно играет важную роль в нашем общении. Более того, когда мы анализируем эквивалентные версии этого гена у других организмов, выясняется, что он участвует в звуковом общении животных. Если у самца зебровой амандины отключен ген FoxP2, он не может петь песню своей подруге, а лишенные гена Foxp2[17] мышата не издают ультразвук, с помощью которого должны общаться с матерью.

Таким образом, ген FOXP2 действительно важен для речевой функции. Проведенный в 2006 году анализ генома неандертальцев показал, что у них был совершенно такой же ген FOXP2, как у нас, но не такой, как у шимпанзе. Различия небольшие, но совершенно очевидные. В последовательностях гена FOXP2 человека и шимпанзе всего два отличия, но мы владеем речью, а они нет.

Анализ генома неандертальцев показал, что они, в отличие от обезьян, могли владеть речью.

А что можно сказать о неандертальцах? Суть ответа на экзаменационный вопрос «Умели ли неандертальцы говорить?» осталась такой же, как когда я отвечал на него в 1995 году, но если вы учитесь сегодня, содержание вашего ответа должно быть совершенно другим. Plus ça change, plus c’est la même chose[18]. С очень большой вероятностью неандертальцы могли говорить. Но пока мы не изобретем машины времени, доказать это будет невозможно.

Если этот рассказ не позволяет сделать однозначный вывод о речевой функции неандертальцев (стандартная ситуация при анализе старых костей), у нас есть солидные доказательства в отношении другой физиологической функции – способности распознавать запахи. Однако прежде чем мы сформулируем долгожданный однозначный ответ, придется сделать обычную для ученых оговорку: мы, в сущности, не знаем, как устроено обоняние. У нас в носу есть клетки, активизирующиеся в результате связывания специфических молекул. Мы улавливаем запахи с помощью белков, называемых обонятельными рецепторами, которые встроены в мембрану нервных клеток, переправляющих сигнал из носа прямо в мозг. Эти белки очень похожи на белки палочек и колбочек сетчатки, ответственных за зрение, только их стимулируют не фотоны света, а химические сигналы. В отличие от зрительных, обонятельных рецепторов существует множество, и каждый, по-видимому, отвечает за связывание определенного набора молекул (запахов). Чтобы еще больше усложнить картину, каждая молекула запаха, вероятно, стимулирует несколько рецепторов.

Как и все белки, обонятельные рецепторы закодированы в генах в виде последовательностей ДНК и упакованы в нашем геноме. У нас около 400 генов обонятельных белков, которые комбинируются невообразимым числом способов, позволяя нам распознавать почти бесконечную палитру запахов. Как они комбинируются, мы точно не знаем. Но есть несколько исключений. В частности, в 2015 году было выполнено исследование из разряда тех, что показывает, что кое-что в генетике человека все же можно понять. Ген OR7D4 кодирует обонятельный рецептор, но на его примере можно разобраться, как мы распознаем запахи, поскольку, к счастью, он регистрирует всего одну молекулу. У разных людей встречаются разные варианты этого гена, и, как ни странно, наличие того или иного варианта строго коррелирует с тем, как мы воспринимаем запах химического вещества под названием «андростенол». Мы точно не знаем, зачем этот содержащийся в составе пота стероид нужен человеку. А вот у свиней это главная молекула, определяющая возможность спаривания.

Андростенол содержится в слюне кабанов и хряков и является главным компонентом запаха некастрированного самца. Если самка готова для спаривания и улавливает этот запах, она принимает специфическую позу. У людей, насколько я понимаю, все происходит иначе, однако некоторые из нас тоже чувствуют запах андростенола. Кто-то отождествляет его с запахом застарелой мочи[19], для кого-то это сладковатый запах, а лично я вообще его не чувствую. Все дело в том, какая аллель гена OR7D4 располагается на 19-й хромосоме.

OR7D4 – совершенно обычный ген. Один из примерно 20 тысяч генов, содержащихся в наших клетках. Примерно тысяча букв (нуклеотидов) в длину, что тоже совершенно обычно для большинства генов. Однако вариации нескольких букв определяют наши ощущения при попадании нам в нос молекул, испускаемых самцами свиней, и это имеет прямую корреляцию с реальными и интуитивными ощущениями, тогда как для генов большинства других обонятельных рецепторов намного сложнее установить, как последовательность гена связана с нашими ощущениями.

Я спросил Мэтью Кобба, одного из авторов исследования, посвященного анализу восприятия этого странного запаха, зачем понадобилось узнавать, как на него реагировали неандертальцы. Ответ был прост: «Потому что мы могли это сделать». Мне нравится такой ответ. Реальная задача работы заключалась не в том, чтобы установить обонятельные ощущения давно умершего человека, а в том, чтобы проследить распространение различных версий гена в современном мире. Проводя такой анализ, Кобб с соавторами пытались доказать, что эта вариабельность связана с разведением домашних свиней на определенном этапе человеческой эволюции (позднее мы увидим, как на генетике человека отразилось разведение молочных пород коров). Но этот небольшой экскурс в глубокое прошлое показывает, как легко современные генетики опрашивают наших далеких предков. Этот простой и, в сущности, не очень важный ген, рассказывает почти медицинскую историю. Наша работа по восстановлению прошлого приняла новый оборот в сфере чувственных ощущений. Теперь мы знаем, что если бы неандерталец столкнулся с резвым хряком, он (или она) в ужасе отшатнулся бы – в отличие от меня, поскольку я на его запах вообще не реагирую.

Одно исследование было посвящено изучению в геноме неандертальца специфического гена под названием MC1R. Этот ген кодирует пигмент кожи и волос. Если кто-то наследует версию этого гена от обоих родителей, у него будут рыжие волосы. Существуют также аллели MC1R, которые обеспечат наличие рыжих волос и очень светлой кожи[20]. Самая распространенная аллель отличается заменой лишь одной буквы (вместо G появляется C) за четверть до конца последовательности гена. Выяснилось, что гены MC1R неандертальцев имели другие мутации, но некоторые из них тоже могли быть светлокожими и рыжеволосыми. От этих людей не осталось волос, да и пигменты не сохраняются столь длительное время. Так что проверить гипотезу можно, если встроить версию гена неандертальца в какой-нибудь маленький организм, с которым легко работать, и посмотреть, что получится. Понятное дело, в этой системе не вырастут волосы, но мы увидим меланосомы, заполненные меланином, и цвет меланина будет соответствовать цвету волос. Результат эксперимента оказался неоднозначным. Так что на вопрос, были ли среди неандертальцев люди с рыжими волосами, ответ такой: возможно были, но не такие, как мы.

Одна из тем данной книги – определение пределов того, что наши гены могут о нас рассказать. Я могу назвать еще несколько генов неандертальцев, которые оказались точно такими же, как у нас, очень похожими на наши или заметно отличающимися от наших. Однако связь между тем, как гены собраны в геноме (генотип), и тем, как они проявляются в виде белков и в конечном счете сказываются на видимых характеристиках организма (фенотип), часто не очень понятна. В геноме неандертальцев были такие же гены с неуклюжими названиями, как у нас, и мы можем поразмышлять о том, в чем заключалась их функция. Одной из важных задач генетики XXI века является установление функции человеческих генов путем манипуляций с их эквивалентами у мышей или путем анализа заболеваний человека, в которых задействованы эти гены. Например, по некоторым данным ген SRGAP2 связан с уровнем интеллекта. Мы (и неандертальцы) имеем больше копий этого гена, чем шимпанзе, и, вероятно, именно поэтому имеем больше связей между нейронами. Или, к примеру, ген HACNS1, участвующий в формировании рук в процессе внутриутробного развития: человеческий ген очень сильно отличается от гена шимпанзе, у которых руки не такие ловкие, как у нас. Однако мы плохо понимаем, в чем заключается функция гена HACNS1 в процессе развития, и, следовательно, какова его роль в эволюции мануальных способностей. И хотя мы расшифровали последовательность практически всех генов в геноме неандертальцев, приходится признать, что в большинстве случаев знания последовательности гена не достаточно для однозначного определения его функции.

Впрочем, это нисколько не подрывает уверенности в успешном развитии генетики. Я упомянул несколько признаков неандертальцев, о которых можно судить по отдельным генам и которые представляются скорее тривиальными – цвет волос или восприятие запахов. Но меня гораздо больше интересует жизнь доисторических людей в более широком плане. Когда мы начинаем рассматривать не отдельные гены, а всю ДНК организма, генетика превращается в геномику. Анализ всего генома неандертальца – гораздо более увлекательная задача, чем инспектирование отдельных генов, поскольку позволяет нам понять кое-что о нас самих. Генетика ответила на вопрос о наших родственных связях с неандертальцами: наша ветвь отделилась от их ветви примерно полмиллиона лет назад. А вот анализ всей ДНК показал, что мы с ними скрещивались, причем неоднократно, возможно, при каждой встрече двух видов.

Как это происходило? Люди одновременно похотливы и подвижны. Нужно сказать, что наша терминология довольно обманчива, во всяком случае, в рамках той временной шкалы, которая нас интересует. Когда мы говорим, что люди пришли из Африки (что они, безусловно, сделали), это звучит так, будто они собрали чемоданы и отправились в Землю обетованную. Наши современные представления о происхождении человека основаны на гипотезе «из Африки», описывающей переселение анатомически современных людей с места их первого появления. Точное время этого события мы определить не в состоянии. Наши предки Homo sapiens прибыли в Европу примерно 60 тысяч лет назад (об этом мы поговорим в главе 2). Но они не перенеслись сюда по волшебству за одну ночь. Маленькие группы людей перемещались во всех направлениях от места появления их предков, это мы можем сказать с уверенностью. Ранние исследования показали, что таких переходов, сопровождавшихся переносом генов, было не меньше пяти. Однако, опять-таки, это не означает, что какие-то пять человек нашли себе пары и произвели потомство, перенесшее свои гены в далекое будущее. Это означает, что представители разных племен скрещивались между собой и обменивались ДНК.

Сегодня последовательность ДНК неандертальцев доступна в виде баз данных, а современный уровень развития технологии позволяет любому человеку просканировать (хотя и не полностью просеквенировать) и проанализировать свой геном в поисках множества разных вещей. Я, например, доверил расшифровку своего генома коммерческой лаборатории 23andMe, о чем расскажу позже. На основании такого персонифицированного исследования генома можно установить, какое количество ДНК неандертальцев хранится в каждом из нас. Например, в моем случае этот показатель составляет 2,7 % (что, по данным компании, является средним показателем для европейца, но университетская наука утверждает, что эти данные завышены). В моем геноме три миллиарда букв, так что, если верить лаборатории 23andMe, примерно 81 миллион из них я получил от неандертальцев. Эта ДНК в виде фрагментов разного размера каким-то образом распределена по моим 23 парам хромосом. Шесть человеческих хромосом, включая Y-хромосому, которая делает меня мужчиной, по размеру меньше генетического наследия неандертальцев! Конечно, ДНК неандертальцев рассредоточена в моем геноме, и ее влияние не ощущается каким-то специфическим образом, но все же она живет во мне.

На протяжении сотни лет мы считали неандертальцев неотесанными пещерными людьми. Восстановленное по костям изображение их черепа отличается от нашего и выглядит не слишком привлекательно. Однако красота – понятие относительное, и хотя нам они не кажутся красавцами, это вовсе не означает, что такого же мнения придерживались наши предки. В любом случае, совершенно очевидно, что эти два вида людей – Homo neanderthalensis и Homo sapiens – вступали в сексуальные контакты.

Во мне есть ДНК неандертальцев, следовательно, они были моими предками. Если у вас есть их ДНК, значит, они были и вашими предками. Если в вас течет европейская кровь, почти наверняка у вас есть ДНК неандертальцев. Включение ДНК отдельной группы индивидов в ДНК родственной группы называется интрогрессией. В частности, интрогрессия происходит при скрещивании представителей различных популяций. С момента обнаружения неандертальцев мы считали их нашими двоюродными братьями или какими-то другими близкими родственниками. Но из результатов генетического анализа следует, что одновременно они были и нашими предками[21]. Это один из важнейших выводов генеалогического ДНК-тестирования, который ломает красивые и четкие гипотетические ветви нашего семейного дерева. Вместо него возникает картина слияния родственных популяций – обмена генов между популяциями, ранее разошедшимися от общего предка.

В геноме разных народов содержится разное количество ДНК неандертальцев: у африканцев ее очень немного, а у некоторых азиатов – больше, чем у европейцев. «Поток генов» – наукоемкий термин для обозначения сути процесса смешивания популяций. Но если говорить всем понятным языком, речь идет о сексуальных отношениях. За всю историю своего существования современные люди много раз имели сексуальные контакты с неандертальцами.

ДНК из костей хорватского неандертальца поведала нам, что мы имели сексуальные контакты с неандертальцами примерно 60 тысяч лет назад, когда Homo sapiens, по-видимому, впервые попал в Евразию. Мы встретились и тут же спарились. Кости, обнаруженные в Румынии, доказывают, что то же самое произошло 40 тысяч лет назад. Начинает казаться, что как только наши предки встречали неандертальцев, они срочно начинали заниматься с ними любовью.

Неандертальская женщина, умершая 50 тысяч лет назад в Алтайских горах в Сибири, вступила в геномный клуб в 2014 году. Кость большого пальца ее ноги стала источником самой подробной генетической информации о людях ее вида. Однако через два года, в феврале 2016-го, еще более подробный анализ ее генома показал, что кое о чем мы не догадывались. Выяснилось, что неандертальская женщина имела некоторое количество ДНК современного Homo sapiens, и путем сравнения ее ДНК с ДНК других неандертальцев было установлено, что интрогрессия произошла примерно за 50 тысяч лет до ее рождения. Мы не знаем, от кого происходит эта ДНК, но мы знаем, что этот «кто-то» был таким, как мы, и уже проделал длинный путь во времени и в пространстве от того места и того времени, где, как мы думали, обосновалась вышедшая из Африки диаспора Homo sapiens. Возможно, эти люди представляли собой первую волну эмигрантов из Африки – направившиеся на восток разведчики, покинувшие родину на десятки тысяч лет раньше, чем мы предполагали. В принципе, это не опровергает гипотезу африканского происхождения людей, но благодаря анализу древней ДНК временные рамки и общий ход истории значительно меняются.

При каждой встрече двух видов людей происходил перенос генов. Впрочем, термин «перенос генов» может ввести в заблуждение, как и термин «миграция». Учитывая широкое распространение ДНК неандертальцев у европейских народов, вряд ли это могло быть результатом однократного совокупления кого-то из наших предков с низкорослым и коренастым человеком из другого племени. Перенос генов происходит на уровне популяций, и вопрос о причинах интрогрессии весьма интересен.

При формировании сперматозоидов и яйцеклеток происходит рекомбинация генов с их случайным перемешиванием, так что набор генов, приобретаемый потомством в результате межвидового скрещивания, тоже случайный. По мере распространения «чужих» генов в результате всех индивидуальных случаев межвидового скрещивания начинает действовать естественный отбор, оценивающий полезность тех или иных генов. Осенью 2015 года были опубликованы результаты нескольких исследований, посвященных изучению эволюции геномного наследия, полученного нами от неандертальцев. Поскольку ДНК наследуется фрагментами, полезность определенных фрагментов генома можно оценить по размеру сохраняющихся в популяции фрагментов. Полезная версия гена, уцелевшая в процессе естественного отбора, может передаваться по наследству вместе с фланкирующими участками ДНК – как пелотон в велосипедной гонке движется вслед за лидером. Но если эти участки опасны, геном постепенно от них избавляется. Сравнивая участки ДНК неандертальцев с участками ДНК современного человека, которые, как мы полагаем, достались нам от неандертальцев, можно получить весьма интересную модель эволюционной успешности таких гибридизаций.

Грэхем Куп с коллегами провели анализ и выяснили, что наш геном медленно очищается от ДНК неандертальцев. Это означает, скорее всего, что ДНК неандертальцев не приносит нам пользы, однако не приносит и явного вреда. Наша ДНК вокруг фрагментов ДНК неандертальцев подвергается слабому негативному отбору: пелотон медленно замедляет движение из-за слабости лидера. Возможно, это имеет отношение к размеру популяции. Вполне вероятно, что численность неандертальцев всегда была невысока. Образцы мтДНК из костей разных неандертальцев очень похожи друг на друга, что указывает на слабое генетическое разнообразие. А это, в свою очередь, свидетельствует о небольшом размере популяции, состоявшей, возможно, из нескольких тысяч человек. Вероятно, когда современные люди встречались с неандертальцами, нас было намного больше. Когда их ДНК смешивалась с нашей, даже если она не давала нам никаких преимуществ, она просто поглощалась более значительным пулом нашей ДНК. А в их геноме она сохранялась, поскольку лучшей ДНК у них просто не было. Келли Харрис и Расмус Нильсон обнаружили аналогичную закономерность и подтвердили, что отбор против интрогрессии не был достаточно сильным и не препятствовал рождению способного к воспроизведению потомства, как это происходит в случае неблизкородственных видов.

Еще кое-что можно прояснить, воспользовавшись математическими расчетами. Количество ДНК неандертальцев относительно ниже на X-хромосоме современного человека, чем на всех остальных хромосомах. X-хромосомы передаются потомству мужчинами только в половине случаев, поскольку у мужчин есть еще Y-хромосома, но женщинами передаются всегда, поскольку у них две X-хромосомы. Таким образом, тот факт, что на нашей X-хромосоме меньше ДНК неандертальцев, может говорить о том, что первые сексуальные контакты, приведшие к появлению потомства, происходили между мужчинами-неандертальцами и женщинами Homo sapiens.

Нужна ли нам зачем-нибудь ДНК неандертальцев? По-видимому, нет. Мы не знаем, почему очень медленно, на протяжении тысяч поколений, мы отторгаем их ДНК. Один из важных выводов из всего этого заключается в том, что эволюция происходит чрезвычайно медленно. Любые сколько-нибудь серьезные негативные элементы ДНК были бы незамедлительно удалены из генома и, вероятно, потеряны навсегда. Тот факт, что ДНК неандертальцев смешивалась с нашей и сохранялась на протяжении тысяч поколений, указывает на отсутствие несовместимости. Это очень тонкий анализ, для которого требуется точная статистическая обработка данных. И этот анализ не подтверждает, что неандертальцы были людьми другого вида.

Мы не можем сказать, как происходили эти сексуальные контакты. Были ли они насильственными или совершались по взаимному согласию? Мы не знаем. Сначала мы встретились в Сибири 100 тысяч лет назад. Мы сосуществовали бок о бок в Европе на протяжении более 5000 лет, что сравнимо с длительностью всей письменной истории человечества. Если сопоставить все, что нам известно о жизни человечества за последние 5000 лет, когда значительная часть событий документировалась, с документальными свидетельствами из доисторического прошлого, можно оценить степень сложности восстановления глубокого прошлого. Мы изучаем наши связи с неандертальцами уже на протяжении нескольких десятилетий и знаем, что жили рядом с ними и скрещивались с ними. Однако некоторые археологические данные показывают, что мы также могли охотиться на других людей и поедать их. Неандертальцы расселились повсюду, и мы могли встречаться на всей территории Евразии, но, возможно также, что их небольшая численность стала проблемой, приведшей к отсутствию генетического разнообразия и, как следствие, к слабому здоровью популяции. Возможно, вместе с генами мы взяли себе их болезни, с которыми они не справились. Мы в конечном итоге их пережили. Неандертальцы были протовидом, тонкой веточкой на эволюционном дереве, недостаточно сильной, чтобы пробиться сквозь эпохи. В чем бы ни заключалась причина их полного исчезновения, мы несем в себе их гены, так что они бессмертны в той же степени, что и мы.

Зуб и фаланга пальца

Алтайские горы вырастают из земли примерно на границе России с Китаем и Монголией. Там холодно и дико. В этой дальней сибирской глуши есть Денисова пещера, названная по имени отшельника, жившего в пещере в XVIII веке. Из-за сурового климата здешние места малодоступны на протяжении большей части года. За 40 лет раскопок отсюда были извлечены на свет останки современных людей – Homo sapiens, и неандертальцев, а также десятков видов животных – от львов и гиен до шерстистых носорогов и, что вполне естественно, поскольку это их родина, множества медведей. С конца 1970-х годов российские ученые обнаружили здесь более 50 тысяч артефактов, относящихся к периоду от глубочайшей древности до Средних веков.

Сибирь – один из наименее населенных регионов планеты; сейчас ее население в среднем составляет около трех человек на квадратный километр. Поэтому тот факт, что пещера, позже названная Денисовой, оставалась в той или иной степени обитаемой на протяжении 230 тысяч лет, является интересным исключением. Дело вот в чем. Несмотря на суровые погодные условия, это очень удобное убежище. Рядом – симпатичная речка (Ануй); пещера имеет удобный широкий прямоугольный вход, открывающийся на юг. При входе – небольшой грот размером девять на одиннадцать метров с отверстием в потолке, служившим одновременно световым окном и дымоходом; от грота отходят три небольшие галереи, ведущие в «спальные» помещения и некое подобие кабинета отшельника. Общая площадь пещеры – 270 м².

В 2008 году на поверхность были извлечены останки одного из самых первых обитателей пещеры. Впрочем, в данном случае слово «останки» звучит чересчур роскошно, поскольку речь идет об одном зубе и одной дистальной фаланге пятого пальца руки молодого человека, говоря нормальным языком, о кончике мизинца ребенка. Учитывая, из какого слоя земли извлекли эти раритеты, их возраст составляет от 30 тысяч до 50 тысяч лет. Единственной фаланги пальца хватило, чтобы палеоантропологи смогли отнести ее бывшего владельца к подсемейству гоминин, к которому относятся все представители рода Homo, а также гориллы и шимпанзе. Но для более точной классификации одной фаланги явно недостаточно.

Однако в этот раз все было иначе. Человеческий зуб оказался крупным, крупнее, чем должен быть у Homo sapiens или Homo neanderthalensis. Но палец рассказал ученым нечто такое, что вновь перевернуло наши представления об эволюции человека.

Для анализа ДНК российские ученые передали кость в лабораторию Сванте Паабо, и им страшно повезло. Команде Паабо удалось выделить из этой маленькой косточки митохондриальный геном (кость при этом разрушилась), и результаты были опубликованы в журнале Nature как раз перед Пасхой 2010 года. Хотя в последовательности, естественно, были пробелы, связанные с неизбежным распадом материала за сотни столетий, результат оказался невероятным. Этот палец принадлежал не нам и не неандертальцу. Ученым не было известно, чтобы в тот период в Европе или Азии жили люди каких-то других видов из рода Homo, но выявленная последовательность ДНК не принадлежала и нашим родственникам приматам, таким как шимпанзе или бонобо. Этот человек (девушка, как мы вскоре узнали) относился к неизвестному ранее виду людей.

На основании ограниченного количества информации, извлеченной из небольшого фрагмента ДНК, удалось установить, что предки девушки вышли из Африки не с предками неандертальцев примерно полмиллиона лет назад и не с нашими предками 100 тысяч лет назад. Количество различий между ДНК того вида, к которому она принадлежала, и ДНК современного человека и неандертальца вдвое превышало количество различий между нами и неандертальцами, и на основании этих данных можно было рассчитать, когда эти три вида разошлись от общего предка.

Итак, примерно миллион лет назад где-то в Африке жила группа людей, которой предстояло дать начало нам, неандертальцам и денисовцам. Это разделение было временным и продлилось всего несколько сотен тысяч лет.

К Рождеству 2010 года была завершена расшифровка оставшейся части генома. В первой статье на эту тему говорилось о «неизвестном гоминиде из Южной Сибири». Окаменелости встречаются не так уж часто, поскольку для превращения кости в камень требуется счастливое стечение обстоятельств. Ученым необыкновенно повезло, поскольку это все же случилось с одной косточкой из 200 костей этой девушки. Причем и ДНК внутри этой кости тоже сохранилась лучше, чем в найденных до сих пор костях неандертальцев.

Судя по размеру кости в сравнении с костями пальцев неандертальцев или современных людей, ее хозяин был молод, почти ребенок. Но о половой принадлежности хозяина нельзя судить по кости. Об этом рассказала ДНК. Да, пол можно определить по ДНК, но только в древних образцах нельзя разглядеть хромосомы. Хромосомы имеют симпатичную и узнаваемую всеми форму только в определенный момент клеточного цикла, и увидеть это можно только в клетках, выделенных из живых организмов. Так что в пальце денисовского человека нельзя было разглядеть Y-хромосому или пару X-хромосом. Исследователи из группы Паабо выделили фрагменты ДНК и встроили их в специальную конструкцию, тоже состоящую из ДНК и предназначенную для включения неизвестных последовательностей. Когда эта так называемая «библиотека» создана, ее можно использовать для воспроизведения интересующей последовательности и ее компьютерного анализа, уже не трогая кость. Один из первых вопросов заключался в том, есть ли в древней ДНК фрагменты, напоминающие ДНК современных Y-хромосом. Ответ оказался отрицательным, так что кость, скорее всего, принадлежала девочке. Ученые любят напоминать другим людям, что отсутствие доказательств – совсем не то же самое, что доказательство отсутствия. Однако в данном случае отсутствие совпадений с Y-хромосомой – вполне достаточное доказательство половой принадлежности. Кроме того, было установлено, что у девочки были карие глаза, каштановые волосы и темная кожа – типичные признаки Homo до появления светлой кожи и голубых глаз в более позднее время (все это мы обсудим в главе 2).

Вторая задача заключалась в том, чтобы установить время расхождения этих людей, нас и неандертальцев от общего предка. Чтобы это сделать, нужно досконально проанализировать несколько фрагментов ДНК из разных видов и сравнить соответствующие последовательности между собой. Чем больше сходство, тем ближе родство. Этот метод работает для всех живых существ – от однояйцевых близнецов до бактерий. Сравнительный анализ показал, что денисовцы и неандертальцы ближе друг к другу, чем к нам. Но совершенно неожиданно выяснилось, что ДНК денисовского человека продолжает жить в геноме современных меланезийцев – жителей островов Фиджи, Папуа – Новая Гвинея и других островов к северо-востоку от Австралии. Как неандертальцы оставили свой след в моем и вашем геноме (если вы евразиец), так эти другие люди, о которых мы знаем исключительно благодаря единственной косточке, передали предкам этих островитян свой генетический отпечаток (до 5 % генома современных меланезийцев).

Жители Тибета адаптированы к большой высоте, поскольку живут на негостеприимных равнинах вокруг Эвереста с низким содержанием кислорода в воздухе. А вот жители северных областей Китая и юга Индии такой адаптации не имеют. В основном эта адаптация связана с геном EPAS1: последовательности ДНК в области этого гена у жителей Тибета и других народов заметно различаются. Сравнивая этот необычный участок ДНК с последовательностями ДНК других близких и дальних народов, ученые пришли к выводу, что эта адаптация передалась потомкам от денисовского человека. Данная интрогрессия позволила жителям Тибета прекрасно чувствовать себя в таких условиях, в которых вы и я неизбежно страдали бы.

Ученые не смогли установить, сколько хромосом было у неандертальцев и денисовцев. Скорее всего, их было столько же, сколько у нас; в частности, это предположение подтверждается успешностью скрещивания наших предков. Однако мы знаем кое-что важное о структуре генома этих людей. Сейчас существует четыре рода гоминид, относящихся к надсемейству человекообразных обезьян: Pan (шимпанзе и бонобо), Pongo (орангутаны), Gorilla (гориллы) и Homo (мы). У первых трех групп 24 пары хромосом, тогда как у нас только 23. Однако все гоминиды, включая нас, фактически имеют в геноме одни и те же гены. Различие связано с нашей хромосомой 2 – это вторая по размеру человеческая хромосома. На самом деле у шимпанзе, орангутанов и горилл тоже есть эта ДНК, только она разделена на две хромосомы. Гены на хромосомах наших лохматых родичей – те же самые и расположены в том же порядке, что и у нас на хромосоме 2. Кроме того, мы можем различить структурные детали бывших независимых хромосом, ставшие ненужными после соединения двух хромосом в одну. На всех хромосомах имеется узкая перемычка, называемая центромерой. Две хромосомы шимпанзе имеют по центромере, а наша двойная хромосома 2 имеет одну нормальную центромеру и остатки другой, что напоминает о нашем родстве с лохматыми существами. Эта последовательность ДНК существует в геноме как неандертальцев, так и денисовцев. Следовательно, такая характеристика Homo существовала еще до того, как все мы разошлись от общего предка.

В 1996 году папа Иоанн Павел II сообщил всему миру, что эволюция представляет собой «больше, чем просто теорию». Хотя этот благородный жест был направлен на примирение науки и религии, на самом деле, он не учитывает тот факт, что в научной терминологии, в отличие от бытовой речи, теория – это вершина интеллектуального труда, оптимальный способ выражения сути природного явления. Теории – лучшее, что у нас есть. В любом случае папа пытался совместить идею об акте божественного творения с неопровержимыми доказательствами нашего происхождения от обезьян, исходя из предпосылки «онтологической прерывистости»: именно в тот момент, когда божественный дух якобы вошел в нас, и должно было произойти слияние этих двух хромосом. Если это так, денисовцы и неандертальцы тоже являются членами нашего закрытого клуба. В противном случае нет никакой прерывистости, а просто неравномерный переход в настоящее.

Какова дальнейшая судьба этих людей? Мы не знаем. История денисовского человека загадочна, и хотя поговаривают о том, что в сибирской пещере были обнаружены еще какие-то кости, пока мы оперируем лишь данными, полученными на основании анализа одного зуба и одной фаланги пальца. В конце 2015 года был найден второй зуб, и мне говорили, что впереди нас ждут новые открытия. Геном денисовского человека (который, по сути, пока представляет собой геном одной девочки – первый зуб на самом деле принадлежал другой молодой особе) отличается и от генома Homo sapiens, и от генома Homo neanderthalensis. Впрочем, самые последние данные показывают, что неандертальцы скрещивались не только с нашими предками, но и с денисовцами. Денисовцы жили независимо от нас на протяжении миллиона лет и независимо от неандертальцев на протяжении 800 тысяч лет. Но в определенный момент какая-то их популяция встретилась с племенем Homo sapiens, и их общие потомки расселились на обширных территориях на Востоке, особенно на Меланезийских островах.

Призрак из прошлого

В этой истории был еще один невероятный поворот (впрочем, я уверен, что в ближайшие месяцы и годы нас ждет множество таких поворотов). В 2013 году генетик из Гарварда Дэвид Рейх, имеющий прямое отношение ко многим историям, изложенным в книге, занялся еще более скрупулезным анализом генома денисовского человека (с применением сложного и чувствительного статистического анализа) и обнаружил нечто труднообъяснимое. По его данным, 400 тысяч лет назад неандертальцы и денисовцы отщепились от ветви, которая в итоге привела к нам. Но при внимательном анализе выяснилось, что геном денисовского человека отличается от нашего чуть в большей степени, чем следовало бы. По мнению Рейха и других ученых, это означает, что они скрещивались с представителями еще какого-то вида, ДНК которого для сравнения у нас нет. Это популяция-призрак, группа людей, о существовании которых мы знаем только по той причине, что они скрестились с другими людьми и в результате оставили свой след в ДНК.

Выдвинуто много предположений о том, кем были эти люди. Некоторые, включая главного в Великобритании специалиста по старым костям Криса Стрингера из Музея естественной истории в Лондоне, считают, что это могли быть представители Homo heidelbergensis, с которыми мы знакомы только по костям, поскольку еще не смогли выделить их ДНК. Но есть и другая возможность, связанная с обнаружением костей, еще больше смазавших и без того туманную картину человеческой эволюции. В пещере Лонглин в районе Гуанси-Чжуан на юго-западе Китая были обнаружены останки странных людей. Они умерли от 11 тысяч до 14 тысяч лет назад, как раз на стыке плейстоцена и голоцена. В эту эпоху, насколько нам известно, существовали только современные люди. Однако эти ребята принадлежали к какой-то другой группе. Они были похожи на нас, но при этом сохранили многие примитивные черты. В пещере обнаружено множество свидетельств того, что эти люди готовили оленину, поэтому их стали называть людьми из Красной оленьей пещеры. Колин Гроувз, один из австралийских исследователей, описавших находку, заметил, что они «были похожи на нас, но не были “нами”», и предположил, что их можно отнести к неизвестному ранее виду людей. До настоящего момента выделить ДНК из их костей не удалось, но некоторые ученые выдвигают предположение, что люди из пещеры Лонглин – результат скрещивания денисовцев и современных людей. Но пока у нас нет ДНК, мы не можем найти ответ на этот вопрос и сориентироваться во все более и более населенном древнем мире.

Вот так сейчас обстоят дела. Если вы хотите использовать старое определение вида, нельзя назвать неандертальцев отдельным видом человека. Денисовцы пока еще не классифицированы в рамках официальной таксономии. ДНК сохранилась плохо, а одной кости пальца и зуба слишком мало для того, чтобы делать выводы. Они были не такими, как мы, и не такими, как неандертальцы, однако мы успешно с ними скрещивались. Эта странная проблема иллюстрирует трудности классификации организмов и нашу привязанность к системе, которая когда-то была создана для демонстрации совершенства акта божественного творения и неизменности организмов во времени. Великая идея Дарвина уничтожила этот идеальный образ, поскольку утверждала, что жизнь непрерывно изменяется. Неизменно только то, что мертво.

Понятно, что червяк – не обезьяна и не может ее оплодотворить. Эти существа разделены сотнями миллионов лет эволюции. Между нами и шимпанзе всего шесть миллионов лет, но мы не можем произвести потомство, хотя, как это не отвратительно звучит, можем вступать в сексуальный контакт. Но анализ ДНК показывает, что все физические различия между человеческими видами, разделенными многими тысячами поколений и лет независимой эволюции, не мешали репродуктивному спариванию.

Насколько мы можем судить, семь миллиардов современных людей представляют собой последнюю группу как минимум из четырех групп, существовавших на Земле 50 тысяч лет назад. Представители одной из этих групп, маленькие люди с острова Флорес, отличались от остальных, по-видимому, в результате своего уединенного существования на островах. Но другие были очень похожи на нас. В ближайшие годы мы тщательнейшим образом изучим кости десятков или сотен древних людей, которых пока еще трудно классифицировать, и которые, сами того не зная, вызвали невероятно горячие споры. Некоторые споры удастся уладить с помощью анализа ДНК, но какие-то не улягутся. Но одно кажется несомненным: древние геномы, которые еще предстоит исследовать, покажут нам, что за тысячи лет до того, как мы стали последними представителями рода Homo, в мире существовало гораздо больше видов людей. За последний миллион лет наш генетический пейзаж упростился, и мы только сейчас начинаем его восстанавливать. Семейное дерево срублено, и мы можем лишь вычерчивать на песке русла ручьев и речушек, ведших к пруду, в котором мы сегодня бултыхаемся.

Такая картина – первичный набросок нашей новой генетической истории. По мере усложнения технологий и обнаружения новых костей мы будем выявлять все больше следов кровосмесительных связей между всеми видами людей в отдаленном прошлом. Учитывая скорость появления новых данных относительно ДНК неандертальцев и денисовцев, нам предстоит быстро и активно пересмотреть представления относительно времени и места обитания тех или иных групп людей и взаимоотношений между ними. Сейчас уже очевидно, что наши прежние упрощенные представления о том, как мы стали такими, как сейчас, были ошибочными. Прошло время красивых раскидистых деревьев, и уже не выдерживает критики изображение постепенного превращения четвероногой обезьяны в двуногого человека. Американский поэт-битник Эдвард Сандерс изобрел слово, которое, на мой взгляд, идеально описывает данную ситуацию. Он употребил его для описания хаоса, и им часто пользуются военные, когда учения идут не так, как надо. Короче говоря, поскольку наша эволюция вовсе не похожа на стройное и красивое деревце, вполне можно сказать, что это был один большой, длившийся миллион лет «кластерфак» (грубо говоря, бесконечная оргия). Всюду и всегда, когда встречались наши предки, неандертальцы и денисовцы, они занимались сексом. Вот было времечко!

Из следующих глав мы узнаем, что семейное дерево никогда не бывает таким, каким его рисуют в генеалогических трудах или в научных статьях, описывающих близкородственные виды, или даже таким, каким его изобразил Дарвин в своем дневнике в 1837 году. Наше племя двуногих людей подвижно и похотливо. Ветви нашего дерева спутаны между собой и втягивают в свой клубок ветви наших родственников, давным-давно отделившихся от нас и даже переставших на нас походить. Неандертальцы, денисовцы и другие, пока еще не знакомые нам родственники, отличались от нас, но вскоре мы узнаем о них больше. Но они слились с нами и остались не только в старых костях, но и в наших клетках. Это прошлое внутри нас. Нет ни начала, ни конца, только подъемы и падения, вновь и вновь, эпоха за эпохой. Древние люди никуда не исчезли, они просто слились с нами.

2

Первый Европейский союз

Лошбур, Люксембург,

8000 лет назад

Мы были здесь до возникновения Европы, евро и трех Рейхов – третьего и самого краткосрочного, нацистского, второго, времен кайзеровской Германии, и первого, называвшегося Священной Римской империей и просуществовавшего на протяжении 844 лет. Мы были здесь до того, как крысы принесли возбудителя чумы, уничтожившей миллионы людей. До горбуна-злодея Ричарда III, до Magna Carta[22], до того, как в 1066 году Британия была в последний раз захвачена иноземцами – войсками Вильгельма Нормандского, который вошел в историю под именем Завоеватель. До первого императора Священной Римской империи, могущественного объединителя Европы Карла Великого. До того как викинги и северные шотландцы вступили на вулканическую землю Исландии. До Первого Никейского собора и до основания христианства. До подъема и падения Римской империи, до времен великих завоеваний Александра, до его знаменитого учителя Аристотеля и греческих городов-государств. До минойцев, микенцев, саксов, пиктов и готов. Мы были здесь еще до того, как появились все эти люди, племена, культуры, войны, технологии и книги. Мы были здесь до начала истории. Европа была нашей землей – от восточных степей до мыса Трафальгар на Атлантике. Это было за тысячи лет до начала истории. Из всех когда-либо появлявшихся на Земле людей Homo sapiens был единственным видом человека, населявшим ту часть континента и острова, которые мы теперь называем Европой, на протяжении последних 30 тысяч лет.

Более древние люди бродили по континенту уже около двух миллионов лет назад. Среди них был Homo erectus, успешно вышедший из родной Африки и расселившийся по всему миру – вплоть до острова Ява на востоке и по всей Западной Европе. Один зуб человека этого вида возрастом 1,4 миллиона лет был найден в пещере в Болгарии, другие кости – в Грузии, во Франции и во многих других уголках Европы. На Британских островах люди появились как минимум миллион лет назад. На протяжении большей части времени теперешние острова соединялись с современной Голландией полосой суши. В песке и глине на берегах современного северного Норфолка обнаружены орудия этих людей и кости мамонтов. Быстро исчезающий в результате эрозии берег открывает для нас эти свидетельства древней жизни. Но хотя до нас дошло множество артефактов, кости этих людей слишком старые и, вероятно, слишком влажные, чтобы в них могла сохраниться генетическая информация.

Неандертальцы тоже расселились по всей Европе (см. главу 1): они жили в Германии (оттуда и произошло их название), во Франции, а также в Восточной Европе, Уэльсе, Израиле и еще дальше к востоку. Это были первые истинные европейцы: они произошли от нашего общего наиболее изученного предка, Homo heidelbergensis, жившего примерно 500–600 тысяч лет назад где-то в сердце Европы и исчезнувшего уже как минимум 200 тысяч лет назад. Мы знаем, что анатомически современный человек прибыл в эти места не ранее 60 тысяч лет назад, медленно перемещаясь к северо-западу со Среднего Востока, а до этого из Африки. Известно, что мы пересеклись во времени и в пространстве с уже жившими тут европейцами – неандертальцами – и несем в себе их ДНК. Наше сосуществование в Европе продолжалось, возможно, около 5000 лет – лишь одно мгновение на эволюционной шкале времени. Однако за это время сменилось 200 поколений людей, происходили перемещения популяций, культурные прорывы, скрещивания и смерти и вообще все нормальные проявления жизни. Мы пережили этих людей, возможно, воевали с ними, и, как предполагают некоторые, даже охотились на них и ели их, и никаких костей или орудий неандертальцев возрастом менее 30 тысяч лет обнаружено не было.

Таким образом, на протяжении нескольких последних десятков тысячелетий Европа была только нашей. За последнее десятилетие и, в частности, благодаря находкам, сделанным в 2015 году, наши представления о происхождении европейцев подверглись значительному пересмотру, главным образом, за счет генетического анализа древней и современной ДНК, но также благодаря данным археологии и филологии. Между временем исчезновения неандертальцев и началом истории человечества европейцы значительно изменились в физическом и культурном плане. На следующих страницах мы поговорим о том, как гены и культура, в первую очередь сельское хозяйство, сформировали современную Европу.

Как и в случае наших самых древних предков, о которых мы говорили в главе 1, восстановление прошлого основано на анализе старых костей и ДНК. Однако имеющихся в нашем распоряжении объектов мало, и найдены они на большом расстоянии друг от друга. Расстояние – не очень серьезная проблема, напротив, местонахождение останков помогает установить характер расселения наших предков по территории континента. А вот то, что останков мало, это плохо, поскольку генетика – сравнительная наука, и чем больше у нас данных, тем точнее вырисовывается общая картина. Но что делать – речь идет о людях, умерших уже много тысяч лет назад.

Самый древний геном европейца извлечен из челюсти 37-тысячелетнего мужчины, которую обнаружили на берегу могучего Дона, в районе села Костёнки на юге России. ДНК этого человека похожа на ДНК более поздних европейских охотников и собирателей, в частности, проживавших на территории Испании на 30 тысяч лет позже, но не похожа на ДНК людей из Восточной Азии. Характерные физические признаки азиатских людей появились около 30 тысяч лет назад в Китае: густые прямые волосы, меньшая плотность потовых желез и особая форма зубов. Но все эти признаки связаны с одним-единственным геном, и вообще все причины генетического сходства и различия между азиатами и европейцами спрятаны глубоко под поверхностью кожи.

Самый старый полный геном современного человека еще старше и извлечен из костей, найденных на берегах другой великой русской реки. Иртыш – главный приток Оби; вместе эти две реки проложили себе путь длиной в несколько тысяч километров от Китая до Карского моря в Арктике. Русский резчик Николай Перистов изготавливает украшения и скульптуры из костей. В 2008 году он бродил по берегу Иртыша в поисках костей для резьбы и обнаружил бедренную кость. Эта кость принадлежала мужчине, жившему 45 тысяч лет назад; теперь его называют усть-ишимским человеком – по месту его воскрешения. Расшифровкой его генома занялись в лабораториях Сванте Паабо и Дэвида Рейха в Лейпциге и Гарварде. Общими усилиями был собран полный геном этого человека, как теперь делается для живых людей.

ДНК усть-ишимского человека имеет общие черты с ДНК восточных азиатов и западных европейцев, в отличие от ДНК человека из Костёнок, которая не похожа на азиатскую ДНК. Таким образом, усть-ишимский человек, по-видимому, был предком как европейцев, так и азиатов, и, следовательно, в генетическом плане представляет людей, пришедших из Африки и еще не разделившихся на тех, кто двинулся к западу, и тех, кто пошел на восток.

Большинство работ по анализу ДНК европейцев охватывает период за последние 10 тысяч лет, когда во всем мире начало развиваться сельское хозяйство. Люди стали приручать разнообразных животных, таких как свиньи, козы, овцы, ламы (собаки были одомашнены еще раньше, вероятно, около 15 тысяч лет назад: люди кормили собак остатками пищи, а собаки защищали людей и помогали охотиться), а также выращивать и обрабатывать растения с помощью неолитических орудий.

Ученые спорят по поводу того, что подтолкнуло людей к сельскохозяйственной деятельности. Климат в Европе в это время был достаточно постоянным, возможно, влажным, и многие крупные животные, процветавшие в период холода (шерстистые носороги, мамонты и другие), оказались на грани исчезновения. В таких условиях одомашнивание животных происходило легче.

Мы можем предположить, что наличие целостной пищевой цепи давало преимущества для здоровья людей, хотя это вопрос спорный, поскольку некоторые археологические данные указывают: после приручения животных люди стали меньше ростом, что может объясняться снижением питательности рациона. Давайте пока не будем заострять внимание на этом тезисе, поскольку его смысл раскроется нам позже, примерно через 10 страниц. Модная сегодня «палео-диета» предлагает исключить из рациона питания приготовленную пищу и углеводы в пользу таких продуктов, которые могли быть доступны охотникам и собирателям палеолита: никакого молока и обработанного зерна, никакой чечевицы, бобов или других выведенных человеком растительных продуктов. Орехи – да, но не арахис, поскольку это сельскохозяйственный продукт. Эта диета основана на несуществующих доказательствах, впрочем, как и большинство модных диет.

Переход к сельскохозяйственной деятельности сопровождался появлением в геноме множества копий гена, кодирующего фермент амилазу; находясь в слюне, этот фермент начинает расщеплять сложные молекулы пищи уже во рту. У некоторых людей имеется 18 копий гена, а у шимпанзе – только две. Амилаза расщепляет пищу, богатую крахмалом и другими углеводами, и помогает превращать их в глюкозу, необходимую в качестве источника энергии для эволюционирующего и потребляющего много энергии мозга. Гораздо лучше этот фермент действует на углеводы, прошедшие кулинарную обработку.

Мы точно не знаем, когда люди научились готовить пищу. Свидетельства разнятся, но 300 тысяч лет назад, когда анатомически современный человек еще не существовал, его предки уже пользовались огнем для обработки продуктов. Увеличение числа генов амилазы, приготовление пищи и увеличение объема мозга в процессе нашей эволюции в период палеолита указывают на положительный отбор, направленный на возможность переваривания богатых питательными веществами клубней. Пока это только гипотеза, которая хорошо вписывается в общую картину и подтверждает связь культуры и генов.

Довольно сложно установить рацион питания древних людей, но генетические данные показывают, что основой «палеодиеты» были орехи, даже если теперь эта диета запрещает есть арахис. Как и все модные диеты, эта, возможно, тоже дает положительный результат, но не благодаря содержащемуся в ней рациональному зерну, а по той причине, что люди, обратившиеся к диете, начинают задумываться о своем режиме питания и перестают поглощать гигантские порции макарон или жареной картошки. Так что, в принципе, диета – это неплохо, но только не нужно утверждать, что она основана на каком-то эволюционном явлении. И помните, что как бы дела ни обстояли в прошлом, сегодня мы живем дольше и лучше, чем когда-либо в истории человечества.

В любом случае сельскохозяйственная революция, произошедшая в начале современной эпохи голоцена, совпала с первыми признаками появления домашних животных. И хотя причины этого перехода до сих пор окончательно не установлены, он изменил абсолютно все в нашей жизни. Переход к оседлой жизни изменил наши гены и кости. Конечно же, изменилась и земля, с которой мы стали обращаться таким неестественным образом. Мне нравится путешествовать по Великобритании на поезде и глядеть на простирающиеся за окном зеленые холмы. Я скучаю по ним, находясь в отъезде. Мне нравится думать о том, как они замышлялись и создавались на протяжении тысяч лет, как люди прокладывали живые изгороди (столь важные для поддержания биоразнообразия), чтобы отгородить друг от друга посевы, домашних животных и хищников, а также защитить частную собственность. Даже грубый дикорастущий кустарник в нагорьях Шотландии и Северной Англии на протяжении тысячелетий использовали под пастбища или выстригали.

Считается, что 12 тысяч лет назад на Земле жило около двух миллионов охотников и собирателей, исчезнувших под натиском сельскохозяйственной революции. Сельское хозяйство, как вирус, распространялось по континентам от места своего зарождения где-то на Среднем Востоке (а также в некоторых других точках в Африке и Китае) и стало главным занятием человека практически на всю остальную часть истории. Сегодня сельское хозяйство ведется в промышленном масштабе и осуществляется монопольными компаниями, контролирующими практически все, что мы едим. Но наша книга не об этом. В момент своего зарождения сельскохозяйственные общины были примитивными мелкими хозяйствами, обнесенными стенами и состоявшими из освобожденных от леса земель и постоянного жилья. Зерно – продукт сезонный, так что для ведения сельского хозяйства требуется планирование. На голодное время запасы нужно складировать и сохранять в бочках и горшках. В удачные годы у людей появлялись избытки еды, привлекавшие других людей, в результате чего такие сообщества разрастались и процветали. Люди – технологический вид, нам нравится научный подход, а сельское хозяйство как раз и есть технология, противоречащая естественному ходу вещей.

Постепенно обработка земли привела к повышению урожайности. И тогда же появилось экономическое неравенство: у кого-то было больше продукта, у кого-то меньше. Одни семьи богатели и имели больше детей, больше культуры и больше технологий. И цикл замкнулся. Во времена Римской империи на земле трудились примерно четверть миллиарда людей, а на подножном корму продолжали существовать не более нескольких миллионов людей где-то в Австралии, Южной Америке и некоторых уголках Африки.

Вопрос о причинах, происхождении и распространении сельскохозяйственной деятельности занимал и продолжает занимать многих антропологов. Теперь к нашему арсеналу доказательств (а вовсе не для их опровержения), таких как археологические находки в виде обломков кухонных и складских инструментов, расположения сельскохозяйственных земель и столь любимых нами костей (как наших, так и съеденных нами животных), добавились генетические данные.

Европейцы любят рассуждать о сельском хозяйстве. Уже 40 лет мы пререкаемся по поводу методов ведения сельского хозяйства на территории Европейского союза и пытаемся выработать единую сельскохозяйственную политику. Наш с вами рассказ тоже касается этой темы, но начинается он вовсе не в Брюсселе. Около 8000 лет назад на Земле жило примерно пять миллионов человек – население современной Норвегии. Эти люди были рассредоточены по всему свету. Они уже дошли до оконечности Южной Америки, достигли Австралии и заселили большую часть островов между ними (по-видимому, за исключением островов юга Тихого океана и Новой Зеландии), и в распоряжении ученых имеются сотни костей и тонны археологических образцов, относящихся к тому времени. Мы только начали собирать воедино геномы этих людей, но под влиянием новых данных наше представление о современной эволюции человека уже изменяется. Значительную часть работы выполняют большие научные коллективы генетиков, археологов и историков, а штаб-квартирой генетических исследований такого рода является лаборатория Дэвида Рейха в Гарварде.

В 2015 году интернациональная команда Рейха выделила ДНК из останков нескольких человек. Среди них был один человек из мрачной пещеры в деревне недалеко от Лошбура в Люксембурге, одна женщина из Штутгарта, а остальные – из пещеры в небольшом шведском городе Мутала. Все они умерли более 75 столетий назад и, наверное, не подозревали, что находились на пороге революции, навсегда преобразившей Европу и весь остальной мир.

Мужчина из Лошбура был охотником. На месте его захоронения обнаружено множество предметов, необходимых для выслеживания и убийства животных, а также кремневые наконечники для копий и ножей, с помощью которых можно разделывать мясо и мастерить ловушки. Скорее всего, 8000 лет назад на плоских землях Северной Европы люди в основном охотились на кабанов. Но этот человек был одним из последних, поскольку с востока шли новые люди, с новыми знаниями, которые предпочитали выращивать животных, а не охотиться на них.

Лошбурского охотника обнаружили в 1935 году, однако ДНК из его верхнего зуба была выделена только в 2014-м. Жительница Штутгарта (которого еще не было) предоставила свой зуб для анализа ДНК в 1982 году. Она относилась к числу людей, занимавшихся сельским хозяйством, и умерла примерно 5000 лет назад. В могиле были найдены типичные предметы культуры линейно-ленточной керамики (резные горшки и сосуды), а также каменные орудия и свидетельства того, что эти люди уже приручили животных. Мутальцы были извлечены на свет совсем недавно. У девяти образцы ДНК были взяты из зубов, а еще у одного – из костей бедра и голени. Как и человек из Лошбура, они были охотниками.

Все три группы отличались друг от друга на генетическом уровне. У обитателей Лошбура и Штутгарта были гены темных волос, у обитателей Лошбура и Муталы – гены голубых глаз. У женщины из Штутгарта выявили 16 копий гена амилазы – это говорит о том, что она использовала в пищу много углеводов, а вот у людей из Лошбура и Муталы их было меньше.

Полученные данные позволяют набросать приблизительный портрет этих людей и уточнить некоторые культурные традиции. Однако, исследуя тонкости генетического строения, Дэвид Рейх с коллегами смогли узнать еще кое-что чрезвычайно важное относительно нашего пребывания в Европе на протяжении последних 10 тысяч лет. Наши представления о генетике европейцев основаны на изучении генов современных, живых людей. Это, безусловно, важно, но теперь мы понимаем, что ДНК современной популяции не обязательно соответствует ДНК популяции, жившей в том же месте несколько тысяч лет назад. Сравнивая геномы людей из Лошбура, Штутгарта и Муталы с геномами 2345 современных европейцев, Рейх смог определить вклад, внесенный древними людьми в общий генофонд современных европейцев. Выяснилось, что современные европейцы происходят от трех разных групп людей. Эти группы, конечно же, не представлены людьми из Лошбура, Штутгарта и Муталы, однако различия между ними отражают вариации генома в пуле современной ДНК.

Первыми европейцами были охотники и собиратели, пришедшие из Африки через центр Евразии 40 тысяч лет назад. Здесь они встретились и скрестились с населявшими Европу неандертальцами. От 9000 до 7000 лет назад в их ДНК включилась ДНК восточных сельскохозяйственных народов. Никто никого не убивал и не уничтожал. Две популяции жили не в непосредственной близости, но в одно и то же время: какое-то количество фермеров, какое-то количество охотников, и постепенно происходила медленная интеграция генов охотников в геном фермеров.

А потом, примерно 5000 лет назад, с востока прибыла новая волна людей. Из российских степей пришла ямная культура[23]. Ее представители разводили овец, жили и перемещались в телегах, делали бронзовые украшения и покрывали тела умерших охрой. Их образ жизни быстро распространился по Центральной Европе вместе с генами и светлой кожей. Сельское хозяйство постепенно стало преобладать и, в конце концов, полностью вытеснило охоту и собирательство. Светлая кожа вытеснила темную, и произошли всякие другие изменения, о которых мы поговорим позже.

Если у вас светлая кожа, вы практически наверняка являетесь продуктом этих трех волн миграции. Сейчас мы начинаем пересматривать историю человечества в свете новой модели потока генов. Еще совсем недавно мы думали, что история человечества – лишь череда того, что эволюционные биологи называют «основополагающими событиями»: небольшие племена все дальше уходят из родной Африки, обустраиваются на новом месте, разрастаются, и отпочковывают новые племена, которые повторяют тот же цикл на новой территории. Ранние генетические исследования (вообще говоря, исследования последнего десятилетия – столь невероятна скорость развития этой науки) показывали, что эта модель вполне может быть справедлива, поскольку в геноме есть кластеры небольших повторяющихся последовательностей ДНК. Кроме того, чем дальше от Африки, тем меньшую генетическую вариабельность в популяции мы должны наблюдать и, в общем-то, это мы и наблюдаем. Но последние исследования учитывают, что теперешние обитатели географической зоны не обязательно являются потомками обитателей этой зоны в прошлом. Это становится понятно, если изучить ситуацию в тех местах, куда добрались современные европейцы: значительная часть населения Северной Америки или Австралии – потомки европейцев, покинувших Европу 500 лет назад, так что их геномы не соответствуют генетическому складу аборигенов. Однако такая нестабильность вовсе не обязательна для гораздо более старых популяций. Например, некорректно предполагать, что современные жители Сибири похожи на первых обитателей американского континента, поскольку 15 тысяч назад между этими землями существовал Берингов перешеек (теперь Берингов пролив). Анализ современной ДНК и древней ДНК из старых костей показывает, что теперешние жители Сибири больше похожи на жителей Восточной Азии, тогда как древние жители Сибири имели больше общего с нативными американцами и имели некоторую примесь крови евразийцев с севера. Это означает, что мы привыкли представлять себе миграцию как линейный импульсный процесс, однако за последние годы выяснилось, что люди постоянно двигались во всех направлениях, дрались и вступали в сексуальные отношения со всеми без разбора. Океаны и горы – серьезные преграды на пути потока генов, но на открытых континентах предел – только горизонт. Наши гены утекали из Азии и втекали в обе Америки.

Однако древние геномы рассказывают не только о наших передвижениях. ДНК – удобный инструмент для воспроизведения прошлого, и мы используем анализ ДНК параллельно с данными археологии и геологии. ДНК рассказывает еще и о поведении. Культура впитывается в наши гены и клетки, как в пол жилищ и пещер и в трясину болот.

Молоко (и мед)

Вообще говоря, наша способность пить молоко – довольно странная вещь. Конечно, по определению, млекопитающие – это те, кто пьет материнское молоко, вырабатываемое молочными железами. Но обычно это прерогатива новорожденных, и когда млекопитающие вырастают, они оставляют детские забавы и перестают питаться молоком.

Но мы представляем собой исключение. Не все народы это делают, но мы на Западе употребляем в пищу молоко в разных видах даже во взрослом возрасте. Молоко пьют европейцы, а также некоторые сельскохозяйственные народы Африки и Среднего Востока. Но так было не всегда. Большинство современных людей не имеют возможности переваривать молоко, не могли этого делать и древние люди.

От рождения все люди имеют фермент лактазу, который кодируется геном LCT и расщепляет молочный сахар лактозу. Клетки выстилки желудка выделяют лактазу, расщепляющую лактозу на два более простых сахара – глюкозу и галактозу (биологи не всегда задумываются над тем, чтобы придумать веществам изящные имена).

На протяжении большей части человеческой истории фермент лактаза был активен только у маленьких детей. После отнятия ребенка от груди активность гена резко снижалась, и в результате большинство взрослых людей не могли переваривать молоко. В отсутствие лактазы или при ее недостаточности лактоза не расщепляется в тонкой кишке и попадает в толстую кишку, где содержатся бактерии, которые ее расщепляют и ферментируют с образованием газов. Это приводит к вздутию живота и скоплению кишечных газов, что, в свою очередь, способствует повышению давления в кишечнике и вызывает диарею и другие неприятные симптомы. Такое состояние называется непереносимостью лактозы. Оно, безусловно, неприятно, но вовсе не смертельно, и знакомо многим взрослым людям, которые выпили молока. Вот почему большинство людей его не пьет.

Исключение составляют выходцы из Европы. В их организме лактаза продолжает работать на протяжении всей жизни. Это необычное явление называется усвояемостью лактозы, и хотя для нас чай с молоком или даже целая кружка какао вполне привычные напитки, мы с вами – редкое исключение. Кроме европейцев, активную лактазу во взрослом возрасте сохраняют лишь представители некоторых народов Африки, Юго-Восточной Азии и Среднего Востока. Но у большинства современных людей молоко вызывает нарушение работы кишечника, о чем я уже говорил.

Генетические основы этого явления хорошо изучены. Способность переваривать молоко во взрослом возрасте связана с некоторыми изменениями ДНК в гене лактазы и вокруг него. У большинства британцев и жителей северных и западных регионов Европы (а также у выходцев из этих областей) примерно за 13 тысяч знаков до начала гена лактазы произошла замена основания C на основание T. Такие мутации происходят достаточно часто, но в данном конкретном случае наши лингвистические метафоры для объяснения законов генетики никак не подходят. Обычно читатель надеется, что все главы, параграфы и предложения книги подчинены общей идее, а каждое предложение вытекает из предыдущего. Однако в генетике гены могут оказывать непосредственное влияние на соседние гены, но бывает и так, что они влияют на гены, расположенные очень-очень далеко на той же или даже на другой хромосоме. Предложение, расположенное в тексте за 13 тысяч знаков до этого места, не имеет никакого смысла, и я бы попросил вас не обращать на него внимания, однако с геномом все по-другому. За 13 тысяч нуклеотидов до начала гена лактазы находится участок ДНК, контролирующий активность этого гена, и мутация в отдаленном контролирующем центре в большинстве случаев как раз и обеспечивает способность взрослых людей пить молоко. Изучая эти и другие минорные вариации на «контролирующем» участке ДНК и сравнивая такие участки в геномах разных людей, можно предположить, что мутация произошла за 5000–10 000 лет до начала нашей эры. Сохранение этого гена наряду с некоторыми другими генетическими элементами в виде единого кластера означает, что естественный отбор благоприятствовал развитию способности переваривать молоко.

И если этот ген не дает каких-либо других преимуществ, кроме как возможность пить молоко (а никаких других реальных преимуществ мы не видим), эволюция могла благоприятствовать его распространению в популяции только при наличии постоянного источника свежего молока. И поэтому данная ситуация рассматривается как классический пример закрепления культурных традиций в геноме – совместной эволюции генов и культуры в тех сообществах, где люди пили молоко домашних животных. Кажется очевидным, какие преимущества получает человек при наличии молока и способности его переваривать, однако это всего лишь догадки. Одно возможное преимущество – постоянное наличие питательного продукта, другое – независимость от сезонных циклов созревания урожая.

Примерно 6000 лет назад молоко стало частью неолитической диеты. Осколки посуды, обнаруженные в Румынии, Турции и Венгрии, сохранили следы спекшейся жидкости, которые были проанализированы с помощью хроматографии в лаборатории Ричарда Эвершеда в Университете Бристоля. В очень длинной трубке, заполненной инертным газом, например гелием, компоненты такой смеси можно разделить на отдельные молекулы, движущиеся с разной скоростью, и идентифицировать при помощи контрольных образцов. И хотя горшки были засыпаны землей на протяжении нескольких тысяч лет, в них были обнаружены молочные жиры. Очевидно, в этой посуде хранили молоко.

Примерно в 5500-х годах до н. э. люди научились делать сыр. В Польше были обнаружены глиняные дуршлаги и сита, напоминающие современные, а в 2012 году из этой древней посуды были извлечены показательные образцы. В плохо отмытой посуде вновь были найдены следы молочных жиров. Сыр – странный продукт, и странно, что мы его едим (вообще говоря, это испорченное молоко). Но производство сыра, возможно, было первым изобретенным человеком способом консервирования, и хранить ценный питательный продукт в твердом виде было весьма разумно (скорее всего, древний сыр больше походил на моцареллу, чем на стилтон). Мы знаем, что много позже римляне ели козий и овечий сыр, а крупный рогатый скот в основном использовали как тягловую силу. Однако римляне писали, что германские и британские народы любили пить молоко.

Немытой посуды, пролежавшей в земле несколько тысячелетий, найдено не очень много, так что для проникновения в тайны прошлого нам нужны другие подсказки. Усвояемость лактозы теперь широко распространена среди европейцев (заметим, что у африканцев и жителей Среднего Востока эта способность обеспечивается другими мутациями, которые, вероятно, имеют иное происхождение), но когда-то, примерно 8000 лет назад, все было иначе. Так что возникает вопрос, в какой момент возникла и как распространялась эта способность.

В 2007 году ученые из Англии и Германии совместными усилиями извлекли останки древних людей из восьми могильников на территории Восточной Германии, Венгрии, Литвы и Польши. Возраст этих людей составлял от 5000 до 5800 лет. Люди, жившие на территории Германии, занимались горшечным ремеслом и вели сельское хозяйство, возможно, перейдя к этому роду деятельности одними из первых в Северной Европе. Из их зубов, ребер и других костей ученые извлекли ДНК. Никто из этих ребят не имел мутации, позволяющей переваривать молоко.

Таким образом, генетические и археологические данные в совокупности позволяют грубо определить временные рамки начала разведения молочных пород животных. Конечно, они приблизительны, но такова природа прошлого – поистине чужой для нас территории. Еще труднее определить, где началось разведение молочных пород животных.

Трудно, но не невозможно. Марк Томас из Университетского колледжа Лондона уже много лет занимается этим вопросом (а также раскрытием других детективных историй из прошлого). В 2009 году на основании археологических и генетических данных он создал компьютерную модель, своеобразный статистический пазл, из которого воссоздал достаточно четкую картину появления молочного производства. Распределение гена лактазы у населения северо-западных областей Европы, включая Скандинавию и Ирландию, показывает, что эта сфера человеческой деятельности зародилась где-то здесь. Также есть гипотеза, что одним из эволюционных преимуществ употребления молока было получение дополнительного количества витамина D, которого не хватает жителям северных регионов: потребление молока может компенсировать отсутствие солнца.

Однако группа Томаса обнаружила и другое. С помощью компьютера ученые смоделировали сценарий распространения активного гена лактазы. Они основывались на археологических данных, таких как артефакты молочного сельского хозяйства (датированные по содержанию радиоактивного углерода-14), в сочетании с анализом специфических генетических различий в трех группах древних людей: собирателей и сельскохозяйственных народов, употреблявших и не употреблявших молоко. Мы знаем, что активный ген лактазы отбирался в процессе эволюции, а не просто повсеместно распространялся случайным образом, так что моделирование позволяет найти точки, где эта версия гена вытеснила версии генов охотников и собирателей и сельскохозяйственных народов, не разводивших молочных животных. Моделирование выявляет не те места, где зародилось молочное производство, а где активный ген лактазы начал вытеснять другие версии гена. В целом результаты моделирования позволили определить географическую зону, где с наибольшей вероятностью эволюционировала аллель усвояемости лактозы: это Словакия с прилежащими территориями Польши на севере и Венгрии на юге. Что соответствует археологическим данным, в частности, следам на посуде, найденной в Венгрии и Польше. Примерно 7500 лет обитатели этих мест занимались сельским хозяйством, выращивая пшеницу, горошек, чечевицу и просо. Они разводили домашний скот, свиней и коз, а также изредка охотились на кабанов и оленей; использовали кремневые и деревянные (но не металлические) орудия и лепили керамические вазы и горшки, которые и дали название этой культуре[24].

Те же ученые из Бристоля, которые занимались анализом грязной посуды, исследовали древние черепки на предмет установления других кулинарных пристрастий наших предков и в 2015 году обнаружили следы меда. Исследователи проанализировали тысячи фрагментов горшков и в четырех горшках из Турции, Дании и Алжира нашли следы пчелиного воска. В другом исследовании на посуде были обнаружены следы мяса. Эти данные показывают, что люди выращивали сельскохозяйственные растения, собирали мед, содержали сельскохозяйственных животных, доили их, готовили пищу и хранили молоко в виде сыра или творога. По мере того как эта культура распространялась по всему континенту, распространялся и активный ген лактазы, позволяющий нам и сегодня использовать ценные продукты молочного производства.

Из этой истории следуют два важных вывода. Во-первых, мы можем ответить на часто задаваемый вопрос: продолжают ли люди эволюционировать? Ответить на этот вопрос в настоящем времени сложно, поскольку мы не видим изменений потока различных версий генов в популяциях людей во всем мире. Эволюция – четырехмерный процесс, он происходит в пространстве и во времени, причем обычно очень медленно. Поэтому для оценки его влияния нужно набраться терпения, а в настоящий момент у нас, кроме того, недостаточно данных. Однако совершенно определенно можно утверждать, что мы эволюционировали в недавнем прошлом, когда были уже такими, как сейчас. Давление естественного отбора, без сомнения, изменилось в результате эволюции нашего поведения и культуры, но история с молоком показывает, что со временем наши гены продолжают изменяться, как и гены любого живого организма.

Второй вывод заключается в том, что мир, в котором мы живем, отчасти сформирован нами – нашей практикой и культурой, самим фактом нашего существования – и наша ДНК, в свою очередь, тоже изменяется. Гены влияют на культуру, культура влияет на гены. Изобретение сельского хозяйства, без сомнения, было одним из наиболее мощных факторов, изменивших нашу культуру и биологию. Так что завтра утром, добавляя в кашу молоко и мед, подумайте о том, что этот завтрак обеспечили вам ваши древние предки, начавшие революцию в культуре и в ДНК (конечно, если вы европеец). Bon appétit!

Голубоглазые блондины

Одно из наиболее заметных различий между современными людьми – это цвет кожи. Мы различаем и классифицируем людей по усредненным тонам кожи. Грубо говоря, мы делим всех на белых и черных. Подробно на тему расы мы поговорим в главе 5, и я объясню, почему генетики не видят смысла в классификации людей по расовым признакам. В некоторых районах Африки, в Австралии и на островах Индийского океана живут люди с самой темной, действительно почти черной, кожей. А кожа некоторых жителей Шотландии или северной части Швеции поразительно бледная, почти прозрачная. И все промежуточные тона представлены достаточно широко. Это не фантазия, это истина: спектр цветов человеческой кожи является непрерывным.

Заметим, что физические признаки европейцев – скорее исключение, чем правило, как и любовь к молоку. Среди нас много блондинов, а у некоторых еще и голубые глаза и светлая кожа. Встречаются даже рыжие. В генетическом смысле все дело в мутациях; как сказано выше, это означает, что ДНК (генотип) отличается от того, что было раньше, и физический результат этого изменения (фенотип) тоже другой.

Рыжий цвет волос – самый редкий в мире (всего 4–5 %). Он объясняется изменениями лишь в одном гене.

Нам известно как минимум 11 генов, напрямую влияющих на цвет кожи и волос. В целом их влияние сводится к определению типа и плотности меланина в наших клетках. Существуют два типа меланина: эумеланин имеет черный или коричневый цвет, тогда как феомеланин – красноватый, и именно он придает волосам рыжий цвет, о чем мы вскоре поговорим. Специализированные клетки кожи, называемые меланоцитами, поглощают ультрафиолетовые солнечные лучи и вырабатывают меланин. Меланин накапливается в маленьких органеллах, называемых меланосомами, которые перемещаются в соседние клетки (поэтому люди на солнце загорают). Они располагаются в верхней части клетки над ядром, защищая ДНК от опасных ультрафиолетовых лучей, способных повреждать двойную спираль. В волосяных фолликулах меланоциты переносят меланосомы в основание растущего волоса, и поэтому наши волосы имеют цвет.

Меланин – конечный продукт метаболической цепи. Цвет кожи и волос человека отчасти зависит от типа и плотности меланина, но также от многих других генов, влияющих на работу меланина. Защита клеточного ядра, которую обеспечивает эумеланин, представляет собой адаптацию к солнечной погоде. Мы, бледнокожие, загораем на солнце и тем самым защищаем свою ДНК (то есть сначала получаем повреждения, а потом защиту, так что я советую использовать солнцезащитный крем), но те, кто живет вблизи экватора под прямыми лучами палящего солнца, защищены от рождения, поскольку имеют гигантские запасы меланина.

Если гены идентифицированы, достаточно легко определить, где и когда произошли соответствующие изменения. Конечно же это не совсем тривиальная задача, поскольку все изменения происходили в разное время и по-разному. Но мы с уверенностью можем заявить, что выходцы из Африки, населявшие Средний Восток и юг Европы 50 тысяч лет назад, были темнокожими. Из анализа ДНК древних людей, обнаруженных в Венгрии и Испании, а также мужчины из Лошбура, следует, что эти охотники и собиратели, жившие 8000 лет назад, тоже имели темную кожу. Никаких генетических свидетельств появления светлой кожи между этими двумя датами у нас нет.

В 2015 году Ян Матиесон и некоторые другие исследователи идентифицировали два важных гена с неуклюжими названиями SLC24A5 и SLC45A2 и показали, что у этих людей не было вариантов данных генов, связанных с депигментацией, то есть со светлой кожей. А вот у живших 7700 лет назад представителей шведского клана из пещеры Мутала были версии генов, ответственные за светлую кожу, а также версия гена HERC2/OCA2, которая тоже способствует появлению светлых волос и кожи, но еще и голубых глаз. Так что шведы уже давно выглядели так, как сейчас.

Новая генетика, анализирующая целые геномы, позволяет нам не только рассуждать о признаках, которые могли бы стать объектом естественного отбора, но и находить строгие доказательства. На настоящий момент наиболее полный обзор древней ДНК был опубликован зимой 2015 года и стал самым массовым воскрешением из мертвых. Эта важная статья Яна Матиесона содержала анализ геномов 230 европейцев, умерших между 6500 и 300 годами до н. э. О некоторых мы уже говорили раньше: мужчина из Лошбура, обитатели пещеры Мутала и некоторые жители Польши и Венгрии. Но на встречу были приглашены также недавно обнаруженные древние персонажи, из чьих черепов ученым удалось извлечь хоть какое-то количество ДНК. Потрогайте свою голову за ухом, и вы обнаружите выступающую твердую кость. Это сосцевидный отросток височной кости. А непосредственно под ним в глубине черепа находится так называемая каменистая часть височной кости (pars petrosa). Название этой кости происходит от латинского слова petrus, что означает «камень»; от этого же корня происходит имя Пётр – камень, на котором Христос выстроил свою церковь. Эта кость и правда твердая и, следовательно, может долго сохранять ДНК.

Таким образом, древний коллектив состоял из представителей анатолийской, иберийской, ямной, полтавкинской и срубной[25] культуры, проживавших на территориях от северного побережья Испании до Алтайских гор от 8000 до 2300 лет назад. На такой большой выборке легче отыскать следы естественного отбора. Современные возможности генетики позволили Матиесону с коллегами обнаружить в геноме следы естественного отбора, проявляющиеся в виде так называемого однонуклеотидного полиморфизма (single nucleotide polymorphism, SNP) – миллионов замен единичных нуклеотидов, рассредоточенных по всему геному. Прежде всего они обнаружили активный ген лактазы, а также некоторые другие варианты генотипа, практически наверняка появившиеся в результате перехода к сельскохозяйственной деятельности. Некоторые замены связаны с синтезом витамина D, что опять-таки свидетельствует об изменении рациона питания и доступности важных питательных компонентов.

Ученые обнаружили признаки отбора вариантов ДНК, связанных с развитием целиакии – воспалительного заболевания кишечника, вызванного чувствительностью к белку пшеницы глютену; по-видимому, это следствие отбора других адаптационных возможностей: например, один вариант гена помогает расщеплять аминокислоту эрготионеин, которой в пшенице немного. Возможно, наличие этой аллели давало некоторые преимущества тем, кто начал разводить злаковые культуры, но за это пришлось поплатиться болезнью кишечника.

Ученые также нашли признаки отбора генов светлой кожи и голубых глаз, хотя, как мы знаем, обитатели пещеры Мутала уже были голубоглазыми блондинами. Гены светлой кожи быстро распространились из восточных областей по всей Европе, и со временем структура популяции изменилась. Изменилась внешность людей, изменился род их деятельности. Люди выросли, а рост, как мы знаем, в основном определяется генами и в меньшей степени факторами окружающей среды.

Представители ямной культуры были кочевниками и, скорее всего, пастухами. Они жили в степях в западной части современной России и имели высокий рост (о чем свидетельствуют их кости). Но гены высокого роста можно обнаружить и в их ДНК; эти гены они принесли с собой с востока 4800 лет назад и распространили дальше по континенту вместе со всеми нововведениями в культуре и способе питания. Но в наибольшей степени эти изменения коснулись Центральной и Северной Европы. На территории Италии и Испании отбор благоприятствовал распространению людей маленького роста, возможно, в связи со спецификой климата и бедным рационом питания.

Постепенно перед нами вырисовывается картина формирования Европейского союза за последние 10 тысяч лет. Мы видим, как на протяжении этого отрезка времени работал естественный отбор. Мы видим связь между перемещением популяций и возникновением новых родов деятельности, особенно сельского хозяйства, и нашим генетическим багажом. Анализ геномов умерших людей позволяет увидеть естественный отбор в действии.

Нам не всегда удается понять, почему были отобраны те или иные гены. Это не такой тип адаптации, о котором нам рассказывают в телевизионных передачах о естественной истории: такие хорошо заметные изменения и приобретения, как бивни для привлечения самок или разнообразные и узкоспециализированные клювы, как у знаменитых вьюрков Дарвина. Тем не менее эти адаптации – тоже результат дарвиновской эволюции: едва заметные вариации ДНК и едва заметные изменения их распространения в популяции. Степень распространения аллелей в популяции отражает силу естественного отбора. По мере обнаружения новых костей наших предков и извлечения из них древней ДНК мы будем находить все больше и больше свидетельств отбора. Этот же подход уже применяется к анализу останков древних азиатов и американцев, а также жителей последних заселенных человеком территорий – южных островов Тихого океана и Новой Зеландии. История, археология и генетика позволяют воссоздать картину не только перемещений человеческих популяций, но и их эволюции: они показывают нам, как мы стали такими, какие мы есть.

Приход рыжих

Те, у кого волосы не рыжие, не понимают, как это ужасно. Люси Монтгомери. Аня из Зеленых мезонинов, 1908 (перевод М. Батищевой)

Если верить газетам, вымирание неизбежно, и это ужасно, так что Аня была права. Бледная кожа и светлые волосы, скорее всего, являются адаптацией к жизни в условиях северного климата, и по сравнению с кожей и волосами африканцев, азиатов и американских аборигенов бледная кожа и светлые волосы являются редкостью. Однако на свете живут еще более странные люди – рыжие.

Рыжий цвет волос объясняется заменой в одном-единственном гене и встречается у 4–5 % населения планеты, так что это поистине редкость. Наибольшая концентрация рыжеволосых людей среди шотландцев (а также жителей Уэльса, Англии и других стран севера Европы), вероятно, является следствием изоляции определенной группы их предков в какой-то исторический период, но точных причин мы не знаем. Около 40 % шотландцев несут в своем геноме хотя бы одну копию этого гена, а каждый десятый имеет рыжие волосы, но в мире в целом это самый редкий цвет волос.

С геном рыжих волос связаны интересные истории. Белок, который кодирует данный ген, называется меланокортиновым рецептором 1-го типа (MC1R) и относится к обширному классу белков с таким же неуклюжим названием: рецепторы, сопряженные с G-белком. Это длинные изогнутые молекулы, пронизывающие клеточную мембрану. Связываясь с сигнальной молекулой на внешней поверхности клетки, они запускают определенный метаболический путь внутри клетки. В частности, MC1R получает сигнальную молекулу из гипофиза и заставляет меланоциты синтезировать меланин. У большинства людей при этом синтезируется коричневый или черный эумеланин, но у людей с мутацией в MC1R образуется феомеланин. Меланосомы накапливаются в основании волосяного фолликула и окрашивают волосы в рыжий цвет.

Конечно же, как всегда в генетике человека, в реальности все не так просто и гораздо более интересно. Данный рецептор состоит из 317 аминокислотных остатков, и в нем возникают разные мутации, приводящие к превращению эумеланина в феомеланин. Вообще все белки построены из аминокислот двадцати видов; каждая аминокислота кодируется последовательностью из трех букв ДНК. Так вот, если в положении 151 в молекуле MC1R аминокислота аргинин заменяется аминокислотой цистеин, человек имеет рыжие волосы. Если в положении 294 вместо аспарагиновой кислоты стоит гистидин, человек тоже имеет рыжие волосы. Существует еще несколько мутаций, которые оказывают такой же эффект, однако в каждом случае получаются разные оттенки рыжего цвета.

В июне 1997 года Джоан Роулинг познакомила мир с мальчиком по имени Гарри Поттер и его лучшим другом Роном Уизли. У Рона есть рыжеволосые братья и сестры, включая идентичных братьев-близнецов Фреда и Джорджа. Через три недели после публикации первой книги о Гарри Поттере по невероятному совпадению были опубликованы результаты обширного исследования рыжеволосых близнецов, включая 25 пар таких близнецов, как в семье Уизли. У них были обнаружены три варианта гена, однозначно связанные с наличием рыжих волос. Однако кое-что интересное показал анализ контрольной группы. В этой группе были разнояйцевые (неидентичные) близнецы, один из которых был рыжим, а другой нет. В пяти случаях из тринадцати у этих близнецов были одинаковые варианты гена MC1R. Это означает, что одной аллели данного гена недостаточно, чтобы у человека были рыжие волосы. Гены никогда не работают в изоляции и почти всегда выполняют несколько функций. Различия между близнецами показали, что есть какие-то другие генетические факторы, влияющие на экспрессию гена MC1R таким образом, что рыжий фенотип либо проявляется, либо нет.

В двух геномах неандертальцев (один из пещеры Эль-Сидрон на северо-западе Испании, другой из пещеры Рипаро ди Меццена в Италии) обнаружены замены в положении 307-го гена MC1R (вместо обычного для нас аргинина там был глицин). Эта вариация не обнаружена у современных людей с рыжими волосами, а образцы волос неандертальцев до нас не дошли. Однако мы можем провести один хитрый эксперимент и попытаться установить эффект этой мутации. Встраивая версию гена неандертальца из испанской пещеры в модельные клетки и высевая эти клетки на чашки Петри, мы увидим, конечно же, не цвет, но активность клеток, а уже по ней будем судить о цвете, который мог бы появиться в результате такой активности. Различные мутации, обнаруженные у современных людей с рыжими волосами, по-разному снижают активность меланоцитов, и тест на чашках как раз показывает снижение функции меланоцитов. Но коррелирует ли это изменение функции с рыжим цветом волос? Возможно. Люди с двумя одинаковыми мутациями были обнаружены в совершенно разных местах – это говорит о том, что мы имеем дело не с парой уродцев из одного племени, и выявление этой необычной ДНК отнюдь не было случайностью. В то время как светлые волосы и голубые глаза практически наверняка являются адаптацией к жизни в северном климате, вариант гена, который имеет место в этих двух случаях, вряд ли возник таким же образом. Как вы знаете, у большинства современных испанцев и итальянцев волосы жгучего черного цвета. Мы складываем воедино фрагменты прошлого и выстраиваем гипотезы, которые подвергаются проверке. Но в данном случае истина нам пока неизвестна.

В июле 2014 года мир содрогнулся, узнав, что в связи с ожидающимися чудовищными изменениями климата генетики предсказывают вымирание рыжеволосых людей. Первый заголовок я увидел в шотландской газете Daily Record, что понятно, учитывая количество рыжих в Каледонии[26]. Выяснилось, что эту новость напечатали все наиболее популярные издания Великобритании, включая Daily Mail, The Times, Guardian, Telegraph, Independent, Mirror и Sun, и снабдили статьи фотографиями рыжеволосых знаменитостей, таких как актеры Кристина Хендрикс, Джулианна Мур и Дэмиэн Льюис, а также принц Гарри. Всколыхнулись все социальные сети и новостные веб-сайты. Позднее эту информацию перепечатали издания всего мира, включая National Geographic, The Week

Конец ознакомительного фрагмента. Купить полную версию.

Сноски

1

Доктор Сьюз, наст. имя Теодор Зойс Гайзель (1904–1991) – американский детский писатель и мультипликатор. – Здесь и далее номерами обозначены прим. переводчика.

2

Филип Ларкин. Вот те стихи. Перевод Г. Яропольского.

3

«Ползком или скачками» – шуточное выражение известных биологов Стивена Джея Гулда и Джона Тернера, относящееся к дискуссии по поводу того, как происходила эволюция – за счет медленных и непрерывных изменений или за счет внезапных прорывов. Эти две концепции так называемого «филетического градуализма» и «прерывистого равновесия» конкурировали между собой на протяжении многих лет. На самом деле, как часто бывает в науке, отчасти справедливы обе. – Здесь и далее звездочкой отмечены комментарии автора.

4

Впрочем, на полях записной книжки Дарвин оставил заметку «никогда не говорить о высших и низших», поскольку направление эволюции нам неизвестно. К примеру, он отмечал, что некоторые виды ракообразных с течением времени упрощаются. Дарвина вообще очень интересовали ракообразные.

5

Сунда (Сундаланд) – ныне затопленный океаном участок суши в Юго-Восточной Азии.

6

Род и вид – две последние ступени классификации, самые узкие в таксономической иерархии. Стандартный ряд состоит из царства (Kingdom), типа (Phylum), класса (Class) или порядка – у растений – порядка (Order), семейства (Family), рода (Genus) и вида (Species). Я заучивал этот ряд по первым буквам слов с помощью мнемонического правила: Kings Play Cards On Fat Girls’ Stomachs («Короли играют в карты на животах толстых девиц»), хотя существует множество других версий. Возможно, вам больше подойдет: King Philip Came Over For Group Sex («Король Филип пришел заняться групповым сексом»).

7

Существует еще более специфическая категория, чем вид, названная подвидом. Так, Gorilla – это род, внутри которого есть несколько видов. Один вид – Gorilla beringei (или восточная горилла), получивший сомнительную привилегию быть названным «в честь» немецкого офицера Фридриха Роберта фон Беринге, первым подстрелившего гориллу этого вида. Самый распространенный вид – Gorilla gorilla (западная горилла), который бывает двух подвидов. Один подвид, западная равнинная горилла, по-латыни называется Gorilla gorilla gorilla. Вполне нормально посмеяться над таким названием, но знайте, что таксономисты – невероятно серьезные люди.

Большинство ученых относят нас с вами к категории «анатомически современный человек» (или неоантроп). Самый старый представитель этого вида жил предположительно около 195 тысяч лет назад (его кости обнаружены в Эфиопии в районе реки Омо). Некоторые ученые используют для нас подвидовое название Homo sapiens sapiens. По-видимому, существовали и другие подвиды современного человека, но все они вымерли. Мне использование подвидового названия в данном случае кажется бесполезным.

8

Некоторые ученые, социологи, писатели и выдумщики выдвигают гипотезы о существовании еще десятков других видов.

9

Несколько слов по поводу криптид – мифологических или неуловимых видов, существование которых не противоречит науке, но и не подтверждено научными данными. На протяжении столетий у многих народов существовали мифы о человекоподобных существах, таких как йети в Гималаях, сасквоч в Канаде, Барману в Юго-Восточной Азии, Мананангал на Филиппинах, йови в Австралии, а также Большая Нога и многие другие в сельских районах Америки. Ни одно из этих существ пока не было исследовано учеными: мы не видели их тел, не видели окаменелостей, не знаем их способов питания и охоты. У нас даже нет ни одного четкого фотоизображения, что странно в мире, где продаются миллиарды фотоаппаратов и мобильных телефонов и живут люди, занимающиеся поиском этих загадочных существ. Когда в 1990-х годах для идентификации и классификации животных стал применяться анализ ДНК, появились (и продолжают появляться) публикации, в которых доказывалось существование некоторых из этих таинственных человеко-обезьян. До настоящего момента все эти доказательства признавались учеными несостоятельными и поддерживались только неугомонной прессой, по крайней мере у нас в Великобритании. На острове Флорес бытует легенда о племени человеко-обезьян Эбу-Гого. Это низкорослые и покрытые шерстью женщины с длинными отвисшими грудями. Безусловно, было бы весьма заманчиво связать легенду с останками давно вымерших Homo floresiensis. Но гораздо более вероятно, что Эбу-Гого – лишь местная версия мифа о низкорослом существе Оранг Пендеке, который рассказывают на Суматре и других островах. Вообще говоря, криптозоологию (поиск легендарных существ) трудно назвать настоящей наукой.

Замечу, что когда я уже дописывал эту книгу, были опубликованы результаты еще двух исследований древних обитателей острова Флорес. В апреле 2016 года Томас Сутикна заново проанализировал возраст костей Homo floresiensis. В пещерах часто бывают нестабильные геологические условия и неравномерное расположение геологических слоев. Лианг-Буа – не исключение, и по последним данным поселение «хоббитов» скорее можно отнести к периоду около 50 тысяч лет назад. В июне 2016 года в 45 км к востоку от пещеры был найден фрагмент челюсти и несколько зубов еще более мелких «хоббитов». Возраст находки оценивается в 700 тысяч лет. Эти люди пока не получили имени. Совершенно очевидно, что в ближайшее время нас ждут новые открытия.

10

Первую Нобелевскую премию Фредерик Сенгер получил в 1958 году за определение аминокислотной последовательности инсулина. До настоящего момента он остается единственным человеком, получившим премию по химии дважды, и одним из четырех людей, дважды удостоенных этой премии в любой номинации. Сенгер умер в то время, пока я писал эту книгу (19 ноября 2013 г.), но его будут помнить благодаря изобретенным им технологиям, и его именем назван институт геномных исследований The Wellcome Trust Sanger Institute вблизи Кембриджа, расположенный неподалеку от того места, где он жил. Это один из важнейших мировых научных центров.

11

Первая строка стихотворения валлийского поэта Дилана Томаса (1914–1953): And death shall have no dominion.

12

Этот процесс происходит еще до рождения. Яйцеклетка, из которой вы появились, образовалась в яичниках вашей матери, когда она была в утробе своей матери. Таким образом, ваша ДНК закладывалась внутри организма вашей бабушки.

13

Кости, обнаруженные в Ла-Шапель-о-Сен в 1908 году, способствовали возникновению стереотипа неандертальцев как «топорно сработанных» пещерных людей с сильной сутулостью. Анализ, проведенный Эриком Тринкаусом в 1980-х годах на современном технологическом уровне, показал, что кости принадлежали сорокалетнему человеку, больному остеоартритом, так что нет причин утверждать, что такими были все неандертальцы.

14

На самом деле практически все животные в фильме относились к Меловому периоду, но слово «меловой» (Cretaceous), наверное, труднее произносить.

15

Многие типы мутаций в ДНК являются причинами нарушений или основанием для эволюции. Большинство влияет на синтез белка, закодированного в этом участке ДНК. Некоторые мутации представляют собой удаление (делецию) одной буквы: «геном» превращается в «гнома». Некоторые добавляют стоп-сигнал, хотя «фраза» еще не закончена. Так называемые бессмысленные мутации, как в случае семьи КЕ, вставляют «знак препинания», так что последовательность изменяется до неузнаваемости. Если мутации не вызывают серьезных проблем и не приводят к смерти, они могут стать предметом естественного отбора, то есть топливом эволюции.

16

Случаи, когда конкретный ген является единственной причиной того или иного признака, подробнее рассматриваются в главе 5.

17

Внимательный читатель, наверное, заметил, что на одной странице ген FOXP2 обозначен тремя способами. Дело в том, что генетики используют разные версии одного и того же написания для обозначения гена из разных видов организмов: так, FOXP2 – человеческий ген, Foxp2 – мышиный, а ген FoxP2 принадлежит зебровой амадине. Почему – не знаю.

18

«Чем больше все меняется, тем больше все остается по-прежнему» – знаменитая фраза французского писателя и журналиста XIX века Альфонса Карра.

19

Мне кажется, именно это почувствовала итальянская туристка, которую вырвало после того, как я попросил ее понюхать пробирку с андростенолом на съемках телевизионной передачи для BBC в 2010 году на цветочном рынке в Ковент-Гардене в Лондоне.

20

Подробнее о рыжих волосах и гене MC1R мы поговорим в главе 2.

21

Я хочу поблагодарить Лару Кассиди из Тринити колледжа в Дублине. Я не задумывался о неандертальцах и проблемах определения пределов вида, пока не побывал на ее лекции. Она была права, а я был неправ. Она заставила меня задуматься, и я ей за это благодарен.

22

Magna Carta (Великая хартия вольностей) – правовой документ, составленный в 1215 году и защищавший юридические права свободного населения средневековой Англии.

23

Ямная (или древнеямная) культура названа так в связи с характерным способом погребения: людей хоронили под курганами в ямах, в положении на спине с согнутыми коленями.

24

Культура линейно-ленточной керамики возникла в Центральной Европе примерно в 5000-х годах до н. э.; характерный признак – украшение грубых глиняных изделий линейным геометрическим рисунком.

25

Полтавкинская культура, для которой еще характерны в основном ямные захоронения, но с переходом к срубным была распространена в Среднем Поволжье в начале и середине бронзового века (в 2700–2100 гг. до н. э.). Срубная культура получила название по характерной манере захоронения людей в деревянных рамах – срубах. Была распространена в Восточной Европе между Днепром и Уралом, с отдельными «островками» в Западной Сибири и на Северном Кавказе в эпоху поздней бронзы.

26

Каледония – историческое и поэтическое название северных районов Великобритании.